Gene detail

Detail information of GWHGAAZE001726

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP29708.1	1.5397E-89	hypothetical protein JCGZ_18643 [Jatropha curcas]
trEMBL	tr\|A0A067K3X5\|A0A067K3X5_JATCU	6E-90	Uncharacterized protein {ECO:0000313\|EMBL:KDP29708.1}

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	58860015	58862162	+
GWHAAZE00000001	mRNA	58860015	58862162	+
GWHAAZE00000001	exon	58860015	58860209	+
GWHAAZE00000001	exon	58861776	58862162	+
GWHAAZE00000001	CDS	58860015	58860209	+
GWHAAZE00000001	CDS	58861776	58862162	+

Transcript Sequence
>GWHTAAZE001730 ATGAAAGGACATCCGGGCACAGGAAAAACCACACTCGCACGCTCGATCGCATCTTCGCTAAAGTGTGCTCTTATTGACAAAGATGATATTCGCGATTGCACTTCTACTCTTCAACACTCCCTTCTCGTCCTACTAAACTCAACCGATGCGGCTTCTAAGATCCTCAACGACCTATCTTACGACGTTGTTTGGCAGGTTGCCTCGACCCAGCTTATGTTAGGACTCAGCGTAGTCATTGACTCGCCTCTCTCTCGACAAGGCCACCTCGACCGGCTTATGCAATTGGCATATTCAACTTCGGCTCAACTTGTCATTGTTGAGTGTAAGCCGCAGGACGAGGAAGAGTGGCGCCGACGGTTGGAACATCGTGGTGCCGGTGATTGCGCGAGCTGGCACAAGCCATCCACGTGGAGGGACATGGAGAGGTTGTTGGAAAGGTACGGTGGATGCACGGATTACGATGTCGTCGATGTTCCGAAGGTGGTTGTTGACACCACGGCGTGTGTCGGAGTTGGAGAACAAGTTTCCTATGTGTTGGAGTTCATTGCCTCTTGTGGTAGACATCGAGTGCACAACTGTTAG

Network for GWHGAAZE001726

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13671.7	AAA_33	1	145	1.80E-16
PF00069.26	Pkinase	115	399	1.50E-69

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	CMGC_CDK-CRK7-CDK9

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	13.958
	SRR3591706	second leaf	2.513
	SRR3591707	mature leaf	7.270
	SRR3591708	Shoot apex	6.765
	SRR3591709	Stem	13.759
	SRR3591710	White floral bud	11.849
	SRR3591711	White flower	6.427
	SRR3591712	Green floral bud	0.840
	SRR3591713	Yellow flower	138.077
SRP173429	SRR8316895	Juvenile bud stage	0.065
	SRR8316896	Juvenile bud stage	0.078
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.289
	SRR8316898	Complete white stage	4.137
	SRR8316899	Complete white stage	0.352
	SRR8316903	Complete white stage	3.211
	SRR8316902	Silver flowering stage	1.327
	SRR8316904	Silver flowering stage	1.440
	SRR8316905	Silver flowering stage	2.929
	SRR8316906	Gold flowering stage	14.339
	SRR8316907	Gold flowering stage	5.481
	SRR8316908	Gold flowering stage	3.652
SRP132670	SRR6706286	Control	1.123
	SRR6706287	Light intensity 50%	1.418
	SRR6706288	Light intensity 20%	0.064
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.791
	CNS0095593	Slightly white alabastrum(diploid) 2	0.135
	CNS0095594	Slightly white alabastrum(diploid) 3	0.781
	CNS0095595	Whole white alabastrum(diploid) 2	0.951
	CNS0095596	Whole white alabastrum(diploid) 3	0.192
	CNS0095597	Whole white alabastrum(diploid) 4	0.087
	CNS0095598	Silvery flower (diploied) 1	19.135
	CNS0095599	Silvery flower (diploied) 2	8.192
	CNS0095600	Silvery flower (diploied) 3	20.335
	CNS0095601	Golden flower (diploid) 1	46.601
	CNS0095602	Golden flower (diploid) 2	79.872
	CNS0095603	Golden flower (diploid) 3	80.780
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.032
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.348
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.151
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.447
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.604
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.141
	CNS0095610	Silvery flower (tetraploid) 1	27.169
	CNS0095611	Silvery flower (tetraploid) 2	32.655
	CNS0095612	Silvery flower (tetraploid) 3	22.056
	CNS0095613	Golden flower (tetraploid) 1	140.335
	CNS0095614	Golden flower (tetraploid) 2	109.819
	CNS0095615	Golden flower (tetraploid) 3	557.115
CRA001975	CRR073297	Stem 1	0.686
	CRR073298	Stem 2	0.562
	CRR073299	Stem 3	1.894
	CRR073300	Leaf 1	0.329
	CRR073301	Leaf 2	0.597
	CRR073302	Leaf 3	0.055
	CRR073303	Juvenile bud 1	0.099
	CRR073304	Juvenile bud 2	2.642
	CRR073305	Juvenile bud 3	0.649
	CRR073306	Third green 1	0.280
	CRR073307	Third green 2	2.645
	CRR073308	Third green 3	1.904
	CRR073309	Second white 1	1.440
	CRR073310	Second white 2	6.777
	CRR073311	Second white 3	4.887
	CRR073312	Silver flowering 1	17.618
	CRR073313	Silver flowering 2	14.522
	CRR073314	Silver flowering 3	12.397
	CRR073315	Gold flowering 1	10.325
	CRR073316	Gold flowering 2	13.405
	CRR073317	Gold flowering 3	9.123
	CRR073318	Tawny withering 1	18.034
	CRR073319	Tawny withering 2	6.454
	CRR073320	Tawny withering 3	14.182