Gene detail

Detail information of GWHGAAZE001739

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP15967.1	1.48527E-85	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q8GXC7\|FBK50_ARATH	1E-28	F-box/kelch-repeat protein At3g06240
trEMBL	tr\|A0A068V5X4\|A0A068V5X4_COFCA	6E-86	Coffea canephora DH200=94 genomic scaffold, scaffold_112 {ECO:0000313\|EMBL:CDP15967.1}
TAIR10	AT4G12560.2	8E-20	F-box and associated interaction domains-containing protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	59231475	59232413	+
GWHAAZE00000001	mRNA	59231475	59232413	+
GWHAAZE00000001	exon	59231475	59232413	+
GWHAAZE00000001	CDS	59231475	59232413	+

Transcript Sequence
>GWHTAAZE001743 ATGTCAGGAAACTACCTTCCCCAAGAGCTCCTAATTCAGATCCTCTTATTGCTACCCCCAAAGTCTCTTCTCAGATTCAGGTGCGTCTCTAAATCTTGGTGCTCTCTAATTTCAAGCTCTAATTTCGTTGATATCCACACACGCAATCTCCCTCACATCACCAACACTCGCAAATTCATCCGCTACTGCACTACTACATCTCCTCGCGAAGAAGTCTATTCAGTGTTTTTCGATAACCAATCGTCGTTCGACCGTGACGATGATGTCAAAATTGATTTCCCCTTTACTAGCAGAACCAAATATAGAAGTGTGGGTTCTTGTAATGGTCTCATTTGCCTGTCAGATGATGAACTTTGCGGCTGCCCATATACAATTGTTCTATGGAATCCTTCAATTAGGAGAAAATTGACCCTTCCCCTTCCCGGCATTATACTAAAGAATATGGGGTATATGTTTGTTCTTGGATTTGGGTTTGATTGCAAGGCTAATGATTACAAGATCGTGAGACTTTCTTACAAAAATGCACGCAATACTAGTTCGTTGCCCCCTTCGGTTGAGGTTTATAGTGTTAGAACTGGGGCATGGAGGCACATTAGTGCTCTCGCTCCTATGTGTCACATCTCCGGGTATTTCTGGCCTCAGGTTTTCGTTAATGGAGCTGCACATTGGGTCGCGTATTCTTTGAATTGCGGACAAATGCGCAGTTTGATTTTGTCCTTTGATATGTGTGATGAGGTATTTCGTGAGATTATGTTGCCTGGATGTTTAGCAGGCGAATCTCATTGGTACATGGGGGTGGTTGTGATACAAGATTCGTTATCTGTTGTAGATTATGATAAATCCCTTAACATGCTTTCGGTTTGGGTCATGAAAGATTACAGTGTTGTTGAGTCTTGGACCAAGCAATATAATATTGATTCGAGGTTGGTTTGGGAATAA

Network for GWHGAAZE001739

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00646.34	F-box	6	42	4.80E-09
PF07734.14	FBA_1	214	307	9.50E-09
PF00847.21	AP2	2	44	9.90E-11

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF
Ubiquitin Family	F-box

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0005515	molecular_function	protein binding
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.124
	SRR3591706	second leaf	0.660
	SRR3591707	mature leaf	0.326
	SRR3591708	Shoot apex	1.111
	SRR3591709	Stem	0.735
	SRR3591710	White floral bud	0.899
	SRR3591711	White flower	0.332
	SRR3591712	Green floral bud	0.827
	SRR3591713	Yellow flower	0.489
SRP173429	SRR8316895	Juvenile bud stage	1.000
	SRR8316896	Juvenile bud stage	1.631
	SRR8316897	Juvenile bud stage	0.278
	SRR8316894	Third green stage	0.470
	SRR8316900	Third green stage	2.180
	SRR8316901	Third green stage	1.599
	SRR8316898	Complete white stage	1.104
	SRR8316899	Complete white stage	2.761
	SRR8316903	Complete white stage	1.104
	SRR8316902	Silver flowering stage	0.267
	SRR8316904	Silver flowering stage	0.459
	SRR8316905	Silver flowering stage	0.363
	SRR8316906	Gold flowering stage	1.403
	SRR8316907	Gold flowering stage	0.476
	SRR8316908	Gold flowering stage	0.922
SRP132670	SRR6706286	Control	2.157
	SRR6706287	Light intensity 50%	2.261
	SRR6706288	Light intensity 20%	2.443
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.353
	CNS0095593	Slightly white alabastrum(diploid) 2	1.067
	CNS0095594	Slightly white alabastrum(diploid) 3	0.681
	CNS0095595	Whole white alabastrum(diploid) 2	1.526
	CNS0095596	Whole white alabastrum(diploid) 3	1.785
	CNS0095597	Whole white alabastrum(diploid) 4	1.427
	CNS0095598	Silvery flower (diploied) 1	1.628
	CNS0095599	Silvery flower (diploied) 2	0.218
	CNS0095600	Silvery flower (diploied) 3	0.925
	CNS0095601	Golden flower (diploid) 1	0.565
	CNS0095602	Golden flower (diploid) 2	1.222
	CNS0095603	Golden flower (diploid) 3	0.856
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.084
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.149
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.336
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.994
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.521
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.613
	CNS0095610	Silvery flower (tetraploid) 1	0.627
	CNS0095611	Silvery flower (tetraploid) 2	0.699
	CNS0095612	Silvery flower (tetraploid) 3	0.963
	CNS0095613	Golden flower (tetraploid) 1	0.098
	CNS0095614	Golden flower (tetraploid) 2	0.406
	CNS0095615	Golden flower (tetraploid) 3	0.329
CRA001975	CRR073297	Stem 1	3.394
	CRR073298	Stem 2	2.170
	CRR073299	Stem 3	4.794
	CRR073300	Leaf 1	1.758
	CRR073301	Leaf 2	1.787
	CRR073302	Leaf 3	2.852
	CRR073303	Juvenile bud 1	2.820
	CRR073304	Juvenile bud 2	1.326
	CRR073305	Juvenile bud 3	2.425
	CRR073306	Third green 1	0.522
	CRR073307	Third green 2	0.332
	CRR073308	Third green 3	0.856
	CRR073309	Second white 1	0.096
	CRR073310	Second white 2	0.288
	CRR073311	Second white 3	0.859
	CRR073312	Silver flowering 1	1.038
	CRR073313	Silver flowering 2	0.098
	CRR073314	Silver flowering 3	0.426
	CRR073315	Gold flowering 1	2.736
	CRR073316	Gold flowering 2	2.700
	CRR073317	Gold flowering 3	2.126
	CRR073318	Tawny withering 1	2.350
	CRR073319	Tawny withering 2	2.288
	CRR073320	Tawny withering 3	2.209