Gene detail

Detail information of GWHGAAZE001741

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP15967.1	1.51814E-72	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9SU30\|CPR30_ARATH	3E-21	F-box protein CPR30
trEMBL	tr\|A0A068V5X4\|A0A068V5X4_COFCA	6E-73	Coffea canephora DH200=94 genomic scaffold, scaffold_112 {ECO:0000313\|EMBL:CDP15967.1}
TAIR10	AT4G12560.2	3E-17	F-box and associated interaction domains-containing protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	59261551	59262381	-
GWHAAZE00000001	mRNA	59261551	59262381	-
GWHAAZE00000001	exon	59261551	59262381	-
GWHAAZE00000001	CDS	59261551	59262381	-

Transcript Sequence
>GWHTAAZE001745 ATGACTACCGTCGAAGTCTACCTTCCCGAGGAGGTCGTCTATCAGATCCTCTCATGGCTACCCCCAAAGTCTCTGCTCCGATTCAGGTGCGTCTGTAAATTTTGGTACTCTCTAATTTCAAGCCCTAATTTCATCAATATCCACACACACAATCTCACCTACATCACCAGCGCTCGCAAACTCATCAGGCACTGCACTTCTACATCTCGTCGCGAAGAAGTCTATTCAGTGTTTTTGGATAACCAATGGTCGTTCGACCGCGACGATGATATCAAAATTGATTTCCCATTTACTAGCAGTGCCAAATATACAATTGTGGGTTATTTTAATGGTCTCATTTGCCTCTCAGATGATGCACATGACTATGCAATTAAAATTGTTCTATGGAACCCTGCAATTAGGAGAAAATTGATCCTTCCCCTGCCCAACATTATACTAAATAATATGGGATATATGTATGTTCTTGGATTTGGGTTTGATTGTAAGGCTAACGATTACAAGATCGTGCGACTTTGTTACGAAAATGCAGGCGATAGTAATAAGTTGCCCCCTTTGGTTGAGGTTTATAGTGTTAAAACTGGGGCATGGAGGGGCATTGCTGCTCCTGCTCCTATGTGTCATATCACTGGTTATTTCTTGGTGCAGGGTTTTGTTAATGGGGCTGCACATTGGGTCGCGTATCCGCAATTCTGCGGACAAATGCGCAGTTTGATTTTGTCCTTTGATATGTGTAATGAGGTCTTTCGTGAGATTATGTTGCCCAAATGTTTAGCGGGTGAATCCCCTTGGTACATGGGGCGGTTGCAATACAAGATTCGTTATCTGTTGTAG

Network for GWHGAAZE001741

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00646.34	F-box	8	44	4.90E-11
PF00226.32	DnaJ	66	127	3.00E-17

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	F-box

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	10.675
	SRR3591706	second leaf	6.300
	SRR3591707	mature leaf	6.663
	SRR3591708	Shoot apex	9.093
	SRR3591709	Stem	6.841
	SRR3591710	White floral bud	6.556
	SRR3591711	White flower	6.464
	SRR3591712	Green floral bud	6.782
	SRR3591713	Yellow flower	5.592
SRP173429	SRR8316895	Juvenile bud stage	4.801
	SRR8316896	Juvenile bud stage	8.500
	SRR8316897	Juvenile bud stage	2.656
	SRR8316894	Third green stage	3.518
	SRR8316900	Third green stage	8.073
	SRR8316901	Third green stage	7.503
	SRR8316898	Complete white stage	4.186
	SRR8316899	Complete white stage	11.272
	SRR8316903	Complete white stage	5.889
	SRR8316902	Silver flowering stage	3.342
	SRR8316904	Silver flowering stage	5.751
	SRR8316905	Silver flowering stage	2.278
	SRR8316906	Gold flowering stage	8.286
	SRR8316907	Gold flowering stage	8.873
	SRR8316908	Gold flowering stage	6.738
SRP132670	SRR6706286	Control	12.928
	SRR6706287	Light intensity 50%	11.822
	SRR6706288	Light intensity 20%	13.824
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.622
	CNS0095593	Slightly white alabastrum(diploid) 2	7.372
	CNS0095594	Slightly white alabastrum(diploid) 3	3.357
	CNS0095595	Whole white alabastrum(diploid) 2	7.545
	CNS0095596	Whole white alabastrum(diploid) 3	4.346
	CNS0095597	Whole white alabastrum(diploid) 4	5.745
	CNS0095598	Silvery flower (diploied) 1	6.559
	CNS0095599	Silvery flower (diploied) 2	4.578
	CNS0095600	Silvery flower (diploied) 3	9.090
	CNS0095601	Golden flower (diploid) 1	6.813
	CNS0095602	Golden flower (diploid) 2	7.452
	CNS0095603	Golden flower (diploid) 3	7.925
	CNS0095604	Slightly white alabastrum(tetraploid) 1	7.206
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.170
	CNS0095606	Slightly white alabastrum(tetraploid) 3	12.476
	CNS0095607	Whole white alabastrum(tetraploid) 1	6.728
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.523
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.692
	CNS0095610	Silvery flower (tetraploid) 1	8.231
	CNS0095611	Silvery flower (tetraploid) 2	8.999
	CNS0095612	Silvery flower (tetraploid) 3	5.809
	CNS0095613	Golden flower (tetraploid) 1	4.390
	CNS0095614	Golden flower (tetraploid) 2	7.509
	CNS0095615	Golden flower (tetraploid) 3	4.928
CRA001975	CRR073297	Stem 1	8.251
	CRR073298	Stem 2	8.810
	CRR073299	Stem 3	8.583
	CRR073300	Leaf 1	12.147
	CRR073301	Leaf 2	9.440
	CRR073302	Leaf 3	10.225
	CRR073303	Juvenile bud 1	7.950
	CRR073304	Juvenile bud 2	4.813
	CRR073305	Juvenile bud 3	6.642
	CRR073306	Third green 1	4.429
	CRR073307	Third green 2	4.262
	CRR073308	Third green 3	3.062
	CRR073309	Second white 1	2.308
	CRR073310	Second white 2	2.796
	CRR073311	Second white 3	2.726
	CRR073312	Silver flowering 1	2.765
	CRR073313	Silver flowering 2	1.851
	CRR073314	Silver flowering 3	3.078
	CRR073315	Gold flowering 1	8.168
	CRR073316	Gold flowering 2	7.283
	CRR073317	Gold flowering 3	4.276
	CRR073318	Tawny withering 1	6.134
	CRR073319	Tawny withering 2	6.670
	CRR073320	Tawny withering 3	5.361