Gene detail

Detail information of GWHGAAZE001757

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008245436.1	1.91722E-38	PREDICTED: uncharacterized protein LOC103343557 [Prunus mume]
trEMBL	tr\|D7U3H5\|D7U3H5_VITVI	2E-36	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI37294.3}

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	59892488	59892880	+
GWHAAZE00000001	mRNA	59892488	59892880	+
GWHAAZE00000001	exon	59892488	59892880	+
GWHAAZE00000001	CDS	59892488	59892880	+

Transcript Sequence
>GWHTAAZE001761 ATGAAACTTACTTACTTAGATAGTAAGAGCAAGGCTTGGAATGCAAGCGTGTGGCCAAACTGGGGCGTTGAAACCGATATCAAAGCTAGTGTTCCACTAATTGCAGGCACAAATGTTGAAATTTCAGCTGACTCTATTGGAGTATTCGAGTGGGAGAAAATGATTGAATGGAGCAACATATCAGAGGCTGTCTACAAGATTACTGCGCCACCGATGACTCGAGTGAAAGTGAATCTACTCGCAACAGAGGGTTCATGTGACGTTCCCTTCTCTTACGACCAGCGTGATACTCTTACGGATGGGAACGTAGTTACTATCACCATGGATGATGGCATTTACACCGGCGTCAATTACTACAATTTCAAGTACGAGACCGAGGAAGAAAAGCTGTGA

Network for GWHGAAZE001757

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00320.28	GATA	110	144	9.40E-15

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C2C2-GATA

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0008270	molecular_function	zinc ion binding
GO:0043565	molecular_function	sequence-specific DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	41.624
	SRR3591706	second leaf	79.743
	SRR3591707	mature leaf	76.352
	SRR3591708	Shoot apex	94.086
	SRR3591709	Stem	11.604
	SRR3591710	White floral bud	119.301
	SRR3591711	White flower	96.352
	SRR3591712	Green floral bud	57.076
	SRR3591713	Yellow flower	21.274
SRP173429	SRR8316895	Juvenile bud stage	7.588
	SRR8316896	Juvenile bud stage	5.340
	SRR8316897	Juvenile bud stage	5.167
	SRR8316894	Third green stage	2.471
	SRR8316900	Third green stage	8.787
	SRR8316901	Third green stage	10.888
	SRR8316898	Complete white stage	6.679
	SRR8316899	Complete white stage	5.735
	SRR8316903	Complete white stage	9.498
	SRR8316902	Silver flowering stage	2.428
	SRR8316904	Silver flowering stage	11.608
	SRR8316905	Silver flowering stage	6.541
	SRR8316906	Gold flowering stage	3.924
	SRR8316907	Gold flowering stage	6.968
	SRR8316908	Gold flowering stage	11.074
SRP132670	SRR6706286	Control	19.656
	SRR6706287	Light intensity 50%	17.523
	SRR6706288	Light intensity 20%	22.370
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.198
	CNS0095593	Slightly white alabastrum(diploid) 2	10.733
	CNS0095594	Slightly white alabastrum(diploid) 3	3.151
	CNS0095595	Whole white alabastrum(diploid) 2	6.823
	CNS0095596	Whole white alabastrum(diploid) 3	10.382
	CNS0095597	Whole white alabastrum(diploid) 4	13.876
	CNS0095598	Silvery flower (diploied) 1	6.120
	CNS0095599	Silvery flower (diploied) 2	3.243
	CNS0095600	Silvery flower (diploied) 3	8.595
	CNS0095601	Golden flower (diploid) 1	1.469
	CNS0095602	Golden flower (diploid) 2	2.491
	CNS0095603	Golden flower (diploid) 3	2.209
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.422
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.381
	CNS0095606	Slightly white alabastrum(tetraploid) 3	5.972
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.635
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.699
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.359
	CNS0095610	Silvery flower (tetraploid) 1	14.122
	CNS0095611	Silvery flower (tetraploid) 2	13.130
	CNS0095612	Silvery flower (tetraploid) 3	21.376
	CNS0095613	Golden flower (tetraploid) 1	6.285
	CNS0095614	Golden flower (tetraploid) 2	5.419
	CNS0095615	Golden flower (tetraploid) 3	11.868
CRA001975	CRR073297	Stem 1	17.669
	CRR073298	Stem 2	16.348
	CRR073299	Stem 3	53.332
	CRR073300	Leaf 1	14.710
	CRR073301	Leaf 2	10.761
	CRR073302	Leaf 3	15.804
	CRR073303	Juvenile bud 1	30.250
	CRR073304	Juvenile bud 2	37.105
	CRR073305	Juvenile bud 3	20.583
	CRR073306	Third green 1	57.088
	CRR073307	Third green 2	139.848
	CRR073308	Third green 3	66.472
	CRR073309	Second white 1	50.043
	CRR073310	Second white 2	12.247
	CRR073311	Second white 3	11.331
	CRR073312	Silver flowering 1	1.789
	CRR073313	Silver flowering 2	5.386
	CRR073314	Silver flowering 3	4.808
	CRR073315	Gold flowering 1	2.262
	CRR073316	Gold flowering 2	6.306
	CRR073317	Gold flowering 3	5.981
	CRR073318	Tawny withering 1	2.537
	CRR073319	Tawny withering 2	1.251
	CRR073320	Tawny withering 3	3.121