Gene detail

Detail information of GWHGAAZE001762

Functional Annotation

Database	Orthologs	E value	Annotation

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	59969350	59969445	-
GWHAAZE00000001	mRNA	59969350	59969445	-
GWHAAZE00000001	exon	59969350	59969445	-
GWHAAZE00000001	CDS	59969350	59969445	-

Transcript Sequence
>GWHTAAZE001766 ATGCATAACAGTTTGCAAATCATGGTATGCTCTTATCACTTCCCCCAATTTCAGAAACACACATCTCAATCTCTCCATTGCAAAAAAGGAAAGTAG

Network for GWHGAAZE001762

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00053	ilvC	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		2-Oxocarboxylic acid metabolism	map01210
		Biosynthesis of amino acids	map01230
		Valine, leucine and isoleucine biosynthesis	map00290
		Pantothenate and CoA biosynthesis	map00770

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0009082	biological_process	branched-chain amino acid biosynthetic process
GO:0004455	molecular_function	ketol-acid reductoisomerase activity
GO:0016491	molecular_function	oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	7.634
	SRR3591706	second leaf	3.213
	SRR3591707	mature leaf	3.257
	SRR3591708	Shoot apex	5.416
	SRR3591709	Stem	4.825
	SRR3591710	White floral bud	10.174
	SRR3591711	White flower	5.746
	SRR3591712	Green floral bud	3.176
	SRR3591713	Yellow flower	6.456
SRP173429	SRR8316895	Juvenile bud stage	5.121
	SRR8316896	Juvenile bud stage	5.390
	SRR8316897	Juvenile bud stage	2.746
	SRR8316894	Third green stage	3.248
	SRR8316900	Third green stage	7.597
	SRR8316901	Third green stage	8.633
	SRR8316898	Complete white stage	2.397
	SRR8316899	Complete white stage	8.192
	SRR8316903	Complete white stage	9.576
	SRR8316902	Silver flowering stage	7.418
	SRR8316904	Silver flowering stage	7.405
	SRR8316905	Silver flowering stage	3.168
	SRR8316906	Gold flowering stage	13.594
	SRR8316907	Gold flowering stage	10.095
	SRR8316908	Gold flowering stage	10.643
SRP132670	SRR6706286	Control	1.028
	SRR6706287	Light intensity 50%	1.760
	SRR6706288	Light intensity 20%	1.652
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.181
	CNS0095593	Slightly white alabastrum(diploid) 2	2.631
	CNS0095594	Slightly white alabastrum(diploid) 3	2.420
	CNS0095595	Whole white alabastrum(diploid) 2	3.935
	CNS0095596	Whole white alabastrum(diploid) 3	2.492
	CNS0095597	Whole white alabastrum(diploid) 4	2.563
	CNS0095598	Silvery flower (diploied) 1	2.144
	CNS0095599	Silvery flower (diploied) 2	8.817
	CNS0095600	Silvery flower (diploied) 3	15.547
	CNS0095601	Golden flower (diploid) 1	2.705
	CNS0095602	Golden flower (diploid) 2	11.393
	CNS0095603	Golden flower (diploid) 3	11.018
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.729
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.747
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.482
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.581
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.007
	CNS0095609	Whole white alabastrum(tetraploid) 3	8.431
	CNS0095610	Silvery flower (tetraploid) 1	16.183
	CNS0095611	Silvery flower (tetraploid) 2	10.678
	CNS0095612	Silvery flower (tetraploid) 3	11.726
	CNS0095613	Golden flower (tetraploid) 1	6.808
	CNS0095614	Golden flower (tetraploid) 2	11.919
	CNS0095615	Golden flower (tetraploid) 3	8.734
CRA001975	CRR073297	Stem 1	2.744
	CRR073298	Stem 2	1.661
	CRR073299	Stem 3	2.357
	CRR073300	Leaf 1	2.231
	CRR073301	Leaf 2	2.000
	CRR073302	Leaf 3	2.957
	CRR073303	Juvenile bud 1	0.930
	CRR073304	Juvenile bud 2	1.721
	CRR073305	Juvenile bud 3	2.416
	CRR073306	Third green 1	3.662
	CRR073307	Third green 2	2.282
	CRR073308	Third green 3	3.093
	CRR073309	Second white 1	1.331
	CRR073310	Second white 2	3.890
	CRR073311	Second white 3	2.677
	CRR073312	Silver flowering 1	2.656
	CRR073313	Silver flowering 2	3.560
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.022
	CRR073316	Gold flowering 2	3.528
	CRR073317	Gold flowering 3	2.990
	CRR073318	Tawny withering 1	1.405
	CRR073319	Tawny withering 2	1.122
	CRR073320	Tawny withering 3	1.011