Gene detail

Detail information of GWHGAAZE001832

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011082928.1	8.21985E-39	PREDICTED: probable xyloglucan endotransglucosylase/hydrolase protein 15 isoform X2 [Sesamum indicum]
Swissprot	tr\|P35694\|XTH2_SOYBN	2E-34	Xyloglucan endotransglucosylase/hydrolase 2 {ECO:0000250\|UniProtKB:Q38857} (Precursor)
trEMBL	tr\|M5XD41\|M5XD41_PRUPE	3E-37	Xyloglucan endotransglucosylase/hydrolase {ECO:0000256\|RuleBase:RU361120}
TAIR10	AT4G14130.1	4E-28	xyloglucan endotransglucosylase/hydrolase 15

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	62296197	62297105	-
GWHAAZE00000001	mRNA	62296197	62297105	-
GWHAAZE00000001	exon	62296197	62296347	-
GWHAAZE00000001	exon	62296427	62296512	-
GWHAAZE00000001	exon	62296697	62296818	-
GWHAAZE00000001	exon	62297012	62297105	-
GWHAAZE00000001	CDS	62297012	62297105	-
GWHAAZE00000001	CDS	62296697	62296818	-
GWHAAZE00000001	CDS	62296427	62296512	-
GWHAAZE00000001	CDS	62296197	62296347	-

Transcript Sequence
>GWHTAAZE001836 ATGGGGCGATCAGCAGCTAAGATACTCAACGGCGGTCAGCTTCTTACTCTATCTCTAGACCATGCTTCTGGAGTGGGTTTCAGTCCAAGAATGAGACACGGGCACGATGAGATTGACTTTGAGTTCTTGGGAAACTCTTCGGGAAATCCGTGCACCGTTCACACAAATGTTTATGCCCAAGGAAAAGGGGAGAAGGAACAACAATTCCATCTCTCGTTTTTGGTGGATAATATTCCCATAAGAGTATTTCACAACAGTGAAGCAATTGGGATACCATTCCCAAAGAATCAACCCATGAGGGTGAATTTGAAGATCGGTGCTTGTGCGATCGCGAGTTCATCTTGTGGTTCAAAGACTACGACTCGCAAACGCAGAGGCGGCAAACTCAAGAACTTGATGGTCGAACAGACTTCGATGGGTGCAAGCAAAACACATGATCTACAACTCTTGTAG

Network for GWHGAAZE001832

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00722.22	Glyco_hydro_16	32	73	6.30E-10
PF00646.34	F-box	7	51	0.00062
PF14299.7	PP2	101	275	2.10E-50

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	F-box

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0005515	molecular_function	protein binding
GO:0004553	molecular_function	hydrolase activity, hydrolyzing O-glycosyl compounds

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.087
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.052
	SRR3591709	Stem	0.254
	SRR3591710	White floral bud	0.756
	SRR3591711	White flower	0.485
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.235
SRP173429	SRR8316895	Juvenile bud stage	0.095
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	8.948
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.027
	SRR8316901	Third green stage	0.145
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.200
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.052
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	2.702
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.031
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.017
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.082
	CNS0095599	Silvery flower (diploied) 2	0.055
	CNS0095600	Silvery flower (diploied) 3	0.096
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.155
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.159
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.087
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.122
	CRR073306	Third green 1	0.321
	CRR073307	Third green 2	0.204
	CRR073308	Third green 3	0.309
	CRR073309	Second white 1	0.199
	CRR073310	Second white 2	0.114
	CRR073311	Second white 3	0.114
	CRR073312	Silver flowering 1	0.677
	CRR073313	Silver flowering 2	0.393
	CRR073314	Silver flowering 3	0.174
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.136
	CRR073317	Gold flowering 3	0.206
	CRR073318	Tawny withering 1	0.036
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000