Gene detail

Detail information of GWHGAAZE001836

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011082926.1	2.14848E-98	PREDICTED: xyloglucan endotransglucosylase/hydrolase protein 24-like isoform X1 [Sesamum indicum]
COG	YP_004104634.1	0.0000003	glycoside hydrolase family protein
Swissprot	tr\|Q38911\|XTH15_ARATH	4E-86	Probable xyloglucan endotransglucosylase/hydrolase protein 15 (Precursor)
trEMBL	tr\|Q1W4A2\|Q1W4A2_CAPAN	8E-97	Xyloglucan endotransglucosylase/hydrolase {ECO:0000256\|RuleBase:RU361120}
TAIR10	AT4G14130.1	9E-70	xyloglucan endotransglucosylase/hydrolase 15

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	62312877	62313835	-
GWHAAZE00000001	mRNA	62312877	62313835	-
GWHAAZE00000001	exon	62312877	62312998	-
GWHAAZE00000001	exon	62313129	62313262	-
GWHAAZE00000001	exon	62313379	62313572	-
GWHAAZE00000001	exon	62313695	62313835	-
GWHAAZE00000001	CDS	62313695	62313835	-
GWHAAZE00000001	CDS	62313379	62313572	-
GWHAAZE00000001	CDS	62313129	62313262	-
GWHAAZE00000001	CDS	62312877	62312998	-

Transcript Sequence
>GWHTAAZE001840 ATGGCGGTCAGCTTCTTACTATCTTTAGACCAGGCTTCTGGAGCAGGGTTTCAGTCCAAGAATGAGTACCTATTCGGTAGGTTTGACATGCAACTGAAACTTGTACCAGGCAACTCTGCTGGCACCGTAACCACCTTCTATTTATCTTCTCAAGGACCTGGGCACAATGAGATCAACTTTGTGTTCTTGGGAAATTCTTCAGGAAATCCATACACAGTTCACACAAATGTTTATGCCCAAGGAAAGGGAGACAAGGAACAACAATTCCATCTTTGGTTCGACCCCACAACAGCCTACCATACATACTCGATTGTTTGGAATGCTCAACATATCACTTTTTTGGTGGACAATATTCCCATAAGAGTATTTCACAATAGTGAAGCAATTGGGATTCCATTCCCAAAGAATCAACCCATGAGGGTGCATGCAAGCCTTCGGAATGCTGATGCTGATGACTGGGCAACACAAGAGTCGCAGCAAACTCAAGAACTTGATGGTGCTGGGCGTAACAGACTTCGGTGGGTACAAGCAAAGCACATGATCTACAACTACCGCAGTGGCGTTAAACGCTTTACTGGGTCTTCCGTCTGA

Network for GWHGAAZE001836

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00722.22	Glyco_hydro_16	6	160	7.80E-47

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0055114	biological_process	oxidation-reduction process
GO:0004553	molecular_function	hydrolase activity, hydrolyzing O-glycosyl compounds
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.708
	SRR3591706	second leaf	1.468
	SRR3591707	mature leaf	0.658
	SRR3591708	Shoot apex	2.392
	SRR3591709	Stem	0.882
	SRR3591710	White floral bud	0.415
	SRR3591711	White flower	0.300
	SRR3591712	Green floral bud	0.297
	SRR3591713	Yellow flower	0.479
SRP173429	SRR8316895	Juvenile bud stage	3.436
	SRR8316896	Juvenile bud stage	4.380
	SRR8316897	Juvenile bud stage	2.005
	SRR8316894	Third green stage	1.173
	SRR8316900	Third green stage	2.532
	SRR8316901	Third green stage	2.024
	SRR8316898	Complete white stage	0.340
	SRR8316899	Complete white stage	1.671
	SRR8316903	Complete white stage	0.781
	SRR8316902	Silver flowering stage	0.634
	SRR8316904	Silver flowering stage	0.118
	SRR8316905	Silver flowering stage	0.113
	SRR8316906	Gold flowering stage	0.277
	SRR8316907	Gold flowering stage	0.343
	SRR8316908	Gold flowering stage	1.221
SRP132670	SRR6706286	Control	0.985
	SRR6706287	Light intensity 50%	1.363
	SRR6706288	Light intensity 20%	1.311
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.569
	CNS0095593	Slightly white alabastrum(diploid) 2	3.840
	CNS0095594	Slightly white alabastrum(diploid) 3	3.609
	CNS0095595	Whole white alabastrum(diploid) 2	3.497
	CNS0095596	Whole white alabastrum(diploid) 3	2.313
	CNS0095597	Whole white alabastrum(diploid) 4	3.039
	CNS0095598	Silvery flower (diploied) 1	1.525
	CNS0095599	Silvery flower (diploied) 2	2.016
	CNS0095600	Silvery flower (diploied) 3	0.932
	CNS0095601	Golden flower (diploid) 1	3.258
	CNS0095602	Golden flower (diploid) 2	1.954
	CNS0095603	Golden flower (diploid) 3	1.881
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.730
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.323
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.667
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.230
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.517
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.753
	CNS0095610	Silvery flower (tetraploid) 1	0.337
	CNS0095611	Silvery flower (tetraploid) 2	0.185
	CNS0095612	Silvery flower (tetraploid) 3	0.592
	CNS0095613	Golden flower (tetraploid) 1	0.192
	CNS0095614	Golden flower (tetraploid) 2	0.398
	CNS0095615	Golden flower (tetraploid) 3	0.055
CRA001975	CRR073297	Stem 1	2.914
	CRR073298	Stem 2	2.428
	CRR073299	Stem 3	0.694
	CRR073300	Leaf 1	2.172
	CRR073301	Leaf 2	2.371
	CRR073302	Leaf 3	0.845
	CRR073303	Juvenile bud 1	1.153
	CRR073304	Juvenile bud 2	0.258
	CRR073305	Juvenile bud 3	0.240
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.558
	CRR073308	Third green 3	0.264
	CRR073309	Second white 1	0.054
	CRR073310	Second white 2	0.257
	CRR073311	Second white 3	0.007
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.006
	CRR073314	Silver flowering 3	0.206
	CRR073315	Gold flowering 1	0.369
	CRR073316	Gold flowering 2	1.137
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.055
	CRR073319	Tawny withering 2	0.894
	CRR073320	Tawny withering 3	0.080