Gene detail

Detail information of GWHGAAZE001840

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011082926.1	1.4048E-102	PREDICTED: xyloglucan endotransglucosylase/hydrolase protein 24-like isoform X1 [Sesamum indicum]
Swissprot	tr\|Q38911\|XTH15_ARATH	7E-90	Probable xyloglucan endotransglucosylase/hydrolase protein 15 (Precursor)
trEMBL	tr\|Q676U4\|Q676U4_NICAT	5E-101	Xyloglucan endotransglucosylase/hydrolase {ECO:0000256\|RuleBase:RU361120} (Fragment)
TAIR10	AT4G14130.1	8E-73	xyloglucan endotransglucosylase/hydrolase 15

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	62332733	62333711	-
GWHAAZE00000001	mRNA	62332733	62333711	-
GWHAAZE00000001	exon	62333571	62333711	-
GWHAAZE00000001	exon	62333249	62333451	-
GWHAAZE00000001	exon	62333009	62333142	-
GWHAAZE00000001	exon	62332733	62332878	-
GWHAAZE00000001	CDS	62333571	62333711	-
GWHAAZE00000001	CDS	62333249	62333451	-
GWHAAZE00000001	CDS	62333009	62333142	-
GWHAAZE00000001	CDS	62332733	62332878	-

Transcript Sequence
>GWHTAAZE001844 ATGGCGGTCAGCTTCTTACTATCTTTAGACCAGGCTTCTGGAGCAGGGTTTCAGTCCAAGAATGAGTACCTATTCGGTAGGTTTGACATGCAACTGAAACTTGTACCAGGCAACTCTGCTGGCACCGTAACCACCTTCTATTTATCTTCTCAAGGACCTGGGCACAATGAGATCAACTTTGTGTTCTTGGGAAATTCTTCAGGAAATCCATACACAGTTCACACAAATGTTTATGCCCAAGGAAAGGGAGACAAGGAACAACAATTCCATCTTTGGTTCGACCCCACAACAGCCTACCATACATACTCGATTGTTTGGAATGCTCAACATATCAATATGTACAATTTTTTGGTGGACAATATTCCCATAAGAGTATTTCACAATAGTGAAGCAATTGGGATTCCATTCCCAAAGAATCAACCCATGAGGGTGCATGCAAGCCTTCGGAATGCTGATGCTGATGACTGGGCAACACAAGAGTCGCAGCAAACTCAAGAACTTGATGGTGCTGGGCGTAACAGACTTCGGTGGGTACAAGCAAAGCACATGATCTACAACTACCGCAGTGACGTTAAACGCTTTACTCGGGGTCTTCCGTCTGAACGTAAACGTTCTAGGTTCTAG

Network for GWHGAAZE001840

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00722.22	Glyco_hydro_16	6	163	7.30E-44
PF14226.7	DIOX_N	3	99	1.80E-16
PF03171.21	2OG-FeII_Oxy	161	254	4.50E-25

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05933	E1.14.17.4	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Cysteine and methionine metabolism	map00270

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0005975	biological_process	carbohydrate metabolic process
GO:0016491	molecular_function	oxidoreductase activity
GO:0004553	molecular_function	hydrolase activity, hydrolyzing O-glycosyl compounds

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.170
	SRR3591706	second leaf	0.747
	SRR3591707	mature leaf	0.307
	SRR3591708	Shoot apex	1.807
	SRR3591709	Stem	0.648
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.093
	SRR3591712	Green floral bud	0.201
	SRR3591713	Yellow flower	0.472
SRP173429	SRR8316895	Juvenile bud stage	2.034
	SRR8316896	Juvenile bud stage	2.882
	SRR8316897	Juvenile bud stage	0.320
	SRR8316894	Third green stage	0.959
	SRR8316900	Third green stage	0.940
	SRR8316901	Third green stage	1.135
	SRR8316898	Complete white stage	0.262
	SRR8316899	Complete white stage	1.610
	SRR8316903	Complete white stage	0.330
	SRR8316902	Silver flowering stage	0.336
	SRR8316904	Silver flowering stage	0.048
	SRR8316905	Silver flowering stage	0.055
	SRR8316906	Gold flowering stage	0.073
	SRR8316907	Gold flowering stage	0.289
	SRR8316908	Gold flowering stage	0.180
SRP132670	SRR6706286	Control	0.599
	SRR6706287	Light intensity 50%	0.814
	SRR6706288	Light intensity 20%	0.275
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.936
	CNS0095593	Slightly white alabastrum(diploid) 2	3.877
	CNS0095594	Slightly white alabastrum(diploid) 3	3.444
	CNS0095595	Whole white alabastrum(diploid) 2	2.617
	CNS0095596	Whole white alabastrum(diploid) 3	2.666
	CNS0095597	Whole white alabastrum(diploid) 4	2.082
	CNS0095598	Silvery flower (diploied) 1	4.241
	CNS0095599	Silvery flower (diploied) 2	0.878
	CNS0095600	Silvery flower (diploied) 3	0.428
	CNS0095601	Golden flower (diploid) 1	4.139
	CNS0095602	Golden flower (diploid) 2	1.116
	CNS0095603	Golden flower (diploid) 3	1.224
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.944
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.805
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.576
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.109
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.559
	CNS0095610	Silvery flower (tetraploid) 1	0.494
	CNS0095611	Silvery flower (tetraploid) 2	0.460
	CNS0095612	Silvery flower (tetraploid) 3	0.356
	CNS0095613	Golden flower (tetraploid) 1	0.395
	CNS0095614	Golden flower (tetraploid) 2	0.342
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	1.596
	CRR073298	Stem 2	1.526
	CRR073299	Stem 3	0.073
	CRR073300	Leaf 1	1.623
	CRR073301	Leaf 2	1.143
	CRR073302	Leaf 3	0.166
	CRR073303	Juvenile bud 1	0.358
	CRR073304	Juvenile bud 2	0.165
	CRR073305	Juvenile bud 3	0.352
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.491
	CRR073308	Third green 3	0.076
	CRR073309	Second white 1	0.052
	CRR073310	Second white 2	0.241
	CRR073311	Second white 3	0.083
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.433
	CRR073316	Gold flowering 2	0.130
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.191
	CRR073319	Tawny withering 2	0.676
	CRR073320	Tawny withering 3	0.175