Gene detail

Detail information of GWHGAAZE001849

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	NP_001291324.1	1.13164E-57	cytochrome P450 CYP72A219-like [Sesamum indicum]
Swissprot	tr\|H2DH21\|C7A29_PANGI	7E-53	Cytochrome P450 CYP72A219
trEMBL	tr\|B3EXG3\|B3EXG3_SESIN	4E-58	Cytochrome P450 monooxygenase {ECO:0000313\|EMBL:AAZ07706.1}
TAIR10	AT3G14650.1	3E-37	cytochrome P450, family 72, subfamily A, polypeptide 11

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	62646342	62648542	+
GWHAAZE00000001	mRNA	62646342	62648542	+
GWHAAZE00000001	exon	62646342	62646606	+
GWHAAZE00000001	exon	62648316	62648542	+
GWHAAZE00000001	CDS	62646342	62646606	+
GWHAAZE00000001	CDS	62648316	62648542	+

Transcript Sequence
>GWHTAAZE001853 ATGTACAACTCAGTTGCAGTGATTTGTGCTGTTGTAGTTGTACTTTGGGCATGGAGATTGTTGAGTTGGGTTTGGTTTAGGCCTAAAAAACTTGAAAAAATCCTCAGAGAGCAAGGACTCAAAGGAAGTTCTTACAAGGTCTTGTTTGGAGATCTTAAGAAAATCTCATCAATGATGAGTGAAGCTAGATCTAAGCCCATCAGTCTTTCCAGTGATATAGTGCCACGTGTCACACCATGGATACTTGATGCCATCAAGAACTATGGCAAGAATTGTTTCTTATGGGCGGGGACAGTACCAAGGGTGTACATTATGGACCCTGAACTTATTAGAGAAGTGTTGCATAAGCCTGACATCTTCAAGAAGCATGGTAATCCAGCATTTAAGAAAATGGCAAATGGGATAACAACCCATCAGGGGGAGAAGTGGGCCAAACACAGGAAAATCATTAACCCTGCGTTCCATGTGGAGAAGTTAAAGGTTTACCCCTAA

Network for GWHGAAZE001849

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00067.23	p450	86	160	2.00E-10
PF05495.13	zf-CHY	18	87	4.20E-15
PF00097.26	zf-C3HC4	142	184	1.50E-05
PF14599.7	zinc_ribbon_6	190	247	5.80E-26

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K10144	RCHY1, PIRH2	Ubiquitin mediated proteolysis	map04120
K10144	RCHY1, PIRH2	p53 signaling pathway	map04115

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0046872	molecular_function	metal ion binding
GO:0008270	molecular_function	zinc ion binding
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.198
	SRR3591706	second leaf	3.684
	SRR3591707	mature leaf	17.678
	SRR3591708	Shoot apex	0.526
	SRR3591709	Stem	6.181
	SRR3591710	White floral bud	3.066
	SRR3591711	White flower	3.463
	SRR3591712	Green floral bud	1.178
	SRR3591713	Yellow flower	6.021
SRP173429	SRR8316895	Juvenile bud stage	3.620
	SRR8316896	Juvenile bud stage	4.881
	SRR8316897	Juvenile bud stage	1.562
	SRR8316894	Third green stage	2.307
	SRR8316900	Third green stage	4.764
	SRR8316901	Third green stage	5.815
	SRR8316898	Complete white stage	4.915
	SRR8316899	Complete white stage	13.906
	SRR8316903	Complete white stage	8.436
	SRR8316902	Silver flowering stage	7.380
	SRR8316904	Silver flowering stage	9.729
	SRR8316905	Silver flowering stage	3.781
	SRR8316906	Gold flowering stage	26.639
	SRR8316907	Gold flowering stage	13.279
	SRR8316908	Gold flowering stage	18.878
SRP132670	SRR6706286	Control	4.748
	SRR6706287	Light intensity 50%	5.735
	SRR6706288	Light intensity 20%	4.854
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.945
	CNS0095593	Slightly white alabastrum(diploid) 2	2.153
	CNS0095594	Slightly white alabastrum(diploid) 3	4.923
	CNS0095595	Whole white alabastrum(diploid) 2	3.262
	CNS0095596	Whole white alabastrum(diploid) 3	2.242
	CNS0095597	Whole white alabastrum(diploid) 4	3.917
	CNS0095598	Silvery flower (diploied) 1	12.470
	CNS0095599	Silvery flower (diploied) 2	13.782
	CNS0095600	Silvery flower (diploied) 3	14.298
	CNS0095601	Golden flower (diploid) 1	10.166
	CNS0095602	Golden flower (diploid) 2	14.761
	CNS0095603	Golden flower (diploid) 3	12.068
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.143
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.356
	CNS0095606	Slightly white alabastrum(tetraploid) 3	8.397
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.872
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.859
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.167
	CNS0095610	Silvery flower (tetraploid) 1	18.030
	CNS0095611	Silvery flower (tetraploid) 2	14.937
	CNS0095612	Silvery flower (tetraploid) 3	2.982
	CNS0095613	Golden flower (tetraploid) 1	4.698
	CNS0095614	Golden flower (tetraploid) 2	12.534
	CNS0095615	Golden flower (tetraploid) 3	4.073
CRA001975	CRR073297	Stem 1	3.465
	CRR073298	Stem 2	3.240
	CRR073299	Stem 3	3.139
	CRR073300	Leaf 1	1.362
	CRR073301	Leaf 2	1.922
	CRR073302	Leaf 3	3.462
	CRR073303	Juvenile bud 1	2.283
	CRR073304	Juvenile bud 2	3.781
	CRR073305	Juvenile bud 3	1.894
	CRR073306	Third green 1	2.677
	CRR073307	Third green 2	2.467
	CRR073308	Third green 3	1.873
	CRR073309	Second white 1	0.931
	CRR073310	Second white 2	2.758
	CRR073311	Second white 3	1.511
	CRR073312	Silver flowering 1	0.444
	CRR073313	Silver flowering 2	1.375
	CRR073314	Silver flowering 3	0.680
	CRR073315	Gold flowering 1	10.891
	CRR073316	Gold flowering 2	24.893
	CRR073317	Gold flowering 3	10.086
	CRR073318	Tawny withering 1	6.916
	CRR073319	Tawny withering 2	9.565
	CRR073320	Tawny withering 3	6.302