Gene detail

Detail information of GWHGAAZE001868

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CBI39912.3	3.977E-171	unnamed protein product [Vitis vinifera]
COG	YP_003706560.1	2E-44	cytochrome P450
Swissprot	tr\|H2DH21\|C7A29_PANGI	4E-167	Cytochrome P450 CYP72A219
trEMBL	tr\|F6I501\|F6I501_VITVI	9E-172	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB62096.1}
TAIR10	AT3G14680.1	1E-122	cytochrome P450, family 72, subfamily A, polypeptide 14

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	63245896	63247459	-
GWHAAZE00000001	mRNA	63245896	63247459	-
GWHAAZE00000001	exon	63245896	63246321	-
GWHAAZE00000001	exon	63246697	63247081	-
GWHAAZE00000001	exon	63247272	63247459	-
GWHAAZE00000001	CDS	63247272	63247459	-
GWHAAZE00000001	CDS	63246697	63247081	-
GWHAAZE00000001	CDS	63245896	63246321	-

Transcript Sequence
>GWHTAAZE001872 ATGGTCTCAACAAACGGGTCGTCTGAGTTGGATGTGTGGCCTTACCTTAAAACTCTAAGTAGTGACGCAATTTCGCGTACAGCATTCGGTAGTAGTTACGAAGAAGGAAGAAAGATATTCCAACTTCAAAAAGAACAAGCCGAGCTTGCAATCCAAGCTACACTATCACTTTACATCCGTGGATTGAGGTACTTGCCAACCAAAAGGAACAAGAGAATGAAGGAGATTGCCAAAGAAGTGGAATTTTTAGTACGAAAAATTATTGATAAAAAAATGAATGCAATAAAGGAAGGAGAAACGAGTAATGATGACTTATTGAGTATGCTGTTGGAAGCAAATATTAAAGAAATTCAACAACACGGAAACAAGAGTGTTGGAATGAGTATTAAAGATGTTATTGAAGAGTGTAAGTTATTTTACTTTGCGGGGCAAGAGACCACCTCAGTTTTGCTGGTTTGGACAATGGTTTCATTAAGCATGCATCCAGACTGGCAAGCGAAAGCCAGAGATGAGGTTTTGCAAGTGTTCGGGAATGAAAAACCAAGTTTCAATGGGTTAAATCGCCTAAAAGTTGTAACTATGATATTGTACGAGGTTTTACGGTTATACCCACCTATAGTTGCCCTAAATCGTAAGGTTATTAAAGAGACTACATTAGGAGAAATATCCTTACCAGCCGAAGTCCAGGTGACATTACCAATAATCCTAATTCATCGTGACCCCGAGCTATGGGGTGATGATGCAAAAGAGTTCAAACCAGATAGATTTTCTGAAGGAGTATCAAAGGCAACAAAGAACCAAGCCGCATTTTTTCCATTTAGCTCGGGACCTCGAATATGTATTGGACAAAATTTCGCAATGTTGGAAGCAAAAATGGCCTTGGCTATGACTTTACAGCGGTTCTCTTTTGAGCTTTCGACATCTTATGCTCATGTTCCTTCCAGGATCATAACTCTTCAACCGCAGTATGGTGCTCATTTGGTTATTCACAAGCTATGA

Network for GWHGAAZE001868

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00067.23	p450	5	306	3.70E-69
PF02969.18	TAF	1	65	5.10E-29
PF07571.14	TAF6_C	262	349	9.20E-34

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03131	TAF6	Basal transcription factors	map03022

Gene Ontology

GO term	Ontology	Name
GO:0006367	biological_process	transcription initiation from RNA polymerase II promoter
GO:0006352	biological_process	DNA-templated transcription, initiation
GO:0055114	biological_process	oxidation-reduction process
GO:0046982	molecular_function	protein heterodimerization activity
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.048
	SRR3591709	Stem	0.104
	SRR3591710	White floral bud	0.452
	SRR3591711	White flower	0.810
	SRR3591712	Green floral bud	0.484
	SRR3591713	Yellow flower	0.722
SRP173429	SRR8316895	Juvenile bud stage	0.029
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.028
	SRR8316901	Third green stage	0.022
	SRR8316898	Complete white stage	0.043
	SRR8316899	Complete white stage	0.133
	SRR8316903	Complete white stage	0.051
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.047
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.047
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.059
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.072
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.044
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.154
	CNS0095596	Whole white alabastrum(diploid) 3	0.067
	CNS0095597	Whole white alabastrum(diploid) 4	0.087
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.050
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.010
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.160
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.051
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.071
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.037
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.074
	CNS0095615	Golden flower (tetraploid) 3	0.015
CRA001975	CRR073297	Stem 1	0.094
	CRR073298	Stem 2	0.148
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.135
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.022
	CRR073304	Juvenile bud 2	0.272
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.006
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.165
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.096
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	1.323
	CRR073319	Tawny withering 2	0.672
	CRR073320	Tawny withering 3	0.050