Gene detail

Detail information of GWHGAAZE001882

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EPS71660.1	8.00339E-15	hypothetical protein M569_03099, partial [Genlisea aurea]
Swissprot	tr\|P42731\|PABP2_ARATH	9E-13	Polyadenylate-binding protein 2
trEMBL	tr\|S8CXH0\|S8CXH0_9LAMI	3E-15	Uncharacterized protein {ECO:0000313\|EMBL:EPS71660.1} (Fragment)
TAIR10	AT4G34110.1	1E-11	poly(A) binding protein 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	63677810	63681074	+
GWHAAZE00000001	mRNA	63677810	63681074	+
GWHAAZE00000001	exon	63677810	63677883	+
GWHAAZE00000001	exon	63678094	63678203	+
GWHAAZE00000001	exon	63680902	63681074	+
GWHAAZE00000001	CDS	63677810	63677883	+
GWHAAZE00000001	CDS	63678094	63678203	+
GWHAAZE00000001	CDS	63680902	63681074	+

Transcript Sequence
>GWHTAAZE001886 ATCATGTCTTCGATCGAGCAGAAGGAAGAGTTGGAAGGTAATGAAGTTAATGCGCAAGGAATCAAGGGGTACAGGAAAGGGAATTTGTGCAGGTATTTAGTGGAATTTAAGGGTGATATTGAGTGGAAGGAGTTTGTTGATCAGTCACTTGAAGCATATCAGGTATGTGGCTCTTTTTTGGAATGCGTGCTACTGGAACTGGATCAGAATAAGGTGCTGCACTTGCTCGAGTCCCCTGAAGCCCTTAAAGCTAAAGTAGCCGAGGCTATGGAATTCCTGAGGAACGTAAGTAATTCCCCTTCTTCTGATCAATTGGATGCATTGTCATTGCGCGATGATGGCGGTCTTGTTTCTTAG

Network for GWHGAAZE001882

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03043	rpoB	RNA polymerase	map03020
		RNA transport	map03013
		mRNA surveillance pathway	map03015
		RNA degradation	map03018

Gene Ontology

GO term	Ontology	Name
GO:0003723	molecular_function	RNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.094
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.368
	SRR3591710	White floral bud	1.169
	SRR3591711	White flower	0.510
	SRR3591712	Green floral bud	1.271
	SRR3591713	Yellow flower	0.630
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.145
	SRR8316897	Juvenile bud stage	0.052
	SRR8316894	Third green stage	0.056
	SRR8316900	Third green stage	0.080
	SRR8316901	Third green stage	0.255
	SRR8316898	Complete white stage	0.140
	SRR8316899	Complete white stage	0.623
	SRR8316903	Complete white stage	0.121
	SRR8316902	Silver flowering stage	0.131
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.133
	SRR6706287	Light intensity 50%	0.070
	SRR6706288	Light intensity 20%	0.178
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.054
	CNS0095593	Slightly white alabastrum(diploid) 2	0.079
	CNS0095594	Slightly white alabastrum(diploid) 3	0.177
	CNS0095595	Whole white alabastrum(diploid) 2	0.137
	CNS0095596	Whole white alabastrum(diploid) 3	0.425
	CNS0095597	Whole white alabastrum(diploid) 4	0.277
	CNS0095598	Silvery flower (diploied) 1	0.109
	CNS0095599	Silvery flower (diploied) 2	0.483
	CNS0095600	Silvery flower (diploied) 3	0.319
	CNS0095601	Golden flower (diploid) 1	0.095
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.035
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.382
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.781
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.431
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.500
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.991
	CNS0095610	Silvery flower (tetraploid) 1	0.381
	CNS0095611	Silvery flower (tetraploid) 2	0.419
	CNS0095612	Silvery flower (tetraploid) 3	0.325
	CNS0095613	Golden flower (tetraploid) 1	0.223
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.576
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.125
	CRR073302	Leaf 3	0.157
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.051
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000