Gene detail

Detail information of GWHGAAZE001887

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KGN47984.1	1.13184E-46	hypothetical protein Csa_6G421780 [Cucumis sativus]
COG	YP_004788769.1	0.00000004	PKD domain-containing protein
Swissprot	tr\|C0LGE0\|Y1765_ARATH	2E-36	Probable LRR receptor-like serine/threonine-protein kinase At1g07650 (Precursor)
trEMBL	tr\|A0A0A0KGL7\|A0A0A0KGL7_CUCSA	4E-47	Uncharacterized protein {ECO:0000313\|EMBL:KGN47984.1}
TAIR10	AT1G07650.2	3E-32	Leucine-rich repeat transmembrane protein kinase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	63791121	63791468	+
GWHAAZE00000001	mRNA	63791121	63791468	+
GWHAAZE00000001	exon	63791121	63791468	+
GWHAAZE00000001	CDS	63791121	63791468	+

Transcript Sequence
>GWHTAAZE001891 ATGTTTTATACAGGAGAGAACTGGGCATTTAGCAGCACCGGGAATTTCATGGACAACGACGTAGATGCCGATGTCTATATCAATTCCAACTCTTCTGCCTTACATAATGTTTCTGCACCCATTTCAGAACTTTATAAAACAGCACGTGTATCCCCCCTCTCTCTCACTTACTATGGTCTCTGTCTTATGAATGGGAATTACACCGTTAAACTCCACTTTGCGGAGATTTTGTTTGCAAACGACCAGTCATTTAACAGCCTTGGAAAGCGTATTTTTGATGTTTACATCCAGGTAACTGAGAAATGCACAAATATTATGGTTATTGGTTATAATGACGACATGGCATGA

Network for GWHGAAZE001887

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0175

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF11721.9	Malectin	24	99	3.20E-20
PF07734.14	FBA_1	189	300	2.30E-08

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	F-box

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	6.964
	SRR3591706	second leaf	21.806
	SRR3591707	mature leaf	27.428
	SRR3591708	Shoot apex	10.154
	SRR3591709	Stem	5.950
	SRR3591710	White floral bud	5.707
	SRR3591711	White flower	8.358
	SRR3591712	Green floral bud	0.864
	SRR3591713	Yellow flower	0.084
SRP173429	SRR8316895	Juvenile bud stage	6.485
	SRR8316896	Juvenile bud stage	5.453
	SRR8316897	Juvenile bud stage	3.231
	SRR8316894	Third green stage	1.036
	SRR8316900	Third green stage	0.050
	SRR8316901	Third green stage	0.636
	SRR8316898	Complete white stage	0.182
	SRR8316899	Complete white stage	3.098
	SRR8316903	Complete white stage	1.502
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.198
	SRR8316905	Silver flowering stage	0.132
	SRR8316906	Gold flowering stage	0.582
	SRR8316907	Gold flowering stage	0.661
	SRR8316908	Gold flowering stage	1.232
SRP132670	SRR6706286	Control	0.866
	SRR6706287	Light intensity 50%	1.160
	SRR6706288	Light intensity 20%	0.889
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.515
	CNS0095593	Slightly white alabastrum(diploid) 2	2.415
	CNS0095594	Slightly white alabastrum(diploid) 3	2.814
	CNS0095595	Whole white alabastrum(diploid) 2	4.005
	CNS0095596	Whole white alabastrum(diploid) 3	0.525
	CNS0095597	Whole white alabastrum(diploid) 4	1.055
	CNS0095598	Silvery flower (diploied) 1	22.383
	CNS0095599	Silvery flower (diploied) 2	11.082
	CNS0095600	Silvery flower (diploied) 3	5.731
	CNS0095601	Golden flower (diploid) 1	13.161
	CNS0095602	Golden flower (diploid) 2	8.539
	CNS0095603	Golden flower (diploid) 3	9.143
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.170
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.679
	CNS0095606	Slightly white alabastrum(tetraploid) 3	6.057
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.936
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.480
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.635
	CNS0095610	Silvery flower (tetraploid) 1	0.803
	CNS0095611	Silvery flower (tetraploid) 2	4.023
	CNS0095612	Silvery flower (tetraploid) 3	1.641
	CNS0095613	Golden flower (tetraploid) 1	0.097
	CNS0095614	Golden flower (tetraploid) 2	0.595
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	1.299
	CRR073298	Stem 2	0.981
	CRR073299	Stem 3	0.621
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.012
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.099
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.601
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.771
	CRR073316	Gold flowering 2	10.268
	CRR073317	Gold flowering 3	1.909
	CRR073318	Tawny withering 1	2.735
	CRR073319	Tawny withering 2	4.657
	CRR073320	Tawny withering 3	4.319