Gene detail

Detail information of GWHGAAZE001888

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010272733.1	4.25431E-78	PREDICTED: probable LRR receptor-like serine/threonine-protein kinase At1g07650 isoform X2 [Nelumbo nucifera]
COG	YP_008151634.1	0.00000001	hypothetical protein SCE1572_26190
Swissprot	tr\|C0LGE0\|Y1765_ARATH	9E-66	Probable LRR receptor-like serine/threonine-protein kinase At1g07650 (Precursor)
trEMBL	tr\|B9T419\|B9T419_RICCO	3E-78	Putative uncharacterized protein {ECO:0000313\|EMBL:EEF29396.1}
TAIR10	AT1G07650.1	1E-53	Leucine-rich repeat transmembrane protein kinase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	63792773	63794262	+
GWHAAZE00000001	mRNA	63792773	63794262	+
GWHAAZE00000001	exon	63792773	63792866	+
GWHAAZE00000001	exon	63792963	63793109	+
GWHAAZE00000001	exon	63793261	63793379	+
GWHAAZE00000001	exon	63794038	63794262	+
GWHAAZE00000001	CDS	63792773	63792866	+
GWHAAZE00000001	CDS	63792963	63793109	+
GWHAAZE00000001	CDS	63793261	63793379	+
GWHAAZE00000001	CDS	63794038	63794262	+

Transcript Sequence
>GWHTAAZE001892 ATGATTTGGACTGTTGGTCTAAAATGGAATGACAGGAACCCTTCTTGTCTCCTATGTGAACGAGTCATTTTCAAGAAGAGCACTATCATACTATACTTCAAACCTCCTGCTGTTCATGGAAAGAAGATTCAAGTTGTTGAAGTAGTTGCGATTGTAAGTGCAGCATCGTTTTTTGTACTTCTATTGCTTGTTATCCTGTGGAGACAAGGCTGTTTGGGAGGCAAAACATCTGTAGATAGAGAGCTTAAAGGCCTAGACCTACAAACAGGACTGTATACACTGAAACAGATCAAAGCTGCAACCAACAACTTTGATCCTGAAAATAAACTAGGGGAGGGTGGTTTTGGTGCCGTTTACAAGGGTCAATTATCGGACGGAACAAGAATTGCAGTGAAGCAACTTTCTACAAAGTCTAAACAAGGAACCCGCGAATTTGTGAATGAAATAGGCATGATCTCTACATTACAACATCCAAATCTAGTAAAGCTATATGGATGCTGTGTTGAAGGAAACCAGTTAGCTCTCATTTACGAGTACATGGAAAATAATTGTCTATCTCGCGCTCTTTTTGGTAAGCCTAGCTAG

Network for GWHGAAZE001888

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0175

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	107	189	1.60E-18
PF00856.29	SET	163	289	2.70E-19

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	SET
Protein Kinases Family	RLK-Pelle_DLSV
Ubiquitin Family	F-box

KEGG pathway

KO	Enzyme	pathway	mapID
K11433	SETMAR	Metabolic pathways	map01100
K11433	SETMAR	Lysine degradation	map00310

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0005515	molecular_function	protein binding
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	6.186
	SRR3591706	second leaf	25.942
	SRR3591707	mature leaf	32.230
	SRR3591708	Shoot apex	12.744
	SRR3591709	Stem	5.666
	SRR3591710	White floral bud	7.378
	SRR3591711	White flower	8.852
	SRR3591712	Green floral bud	0.700
	SRR3591713	Yellow flower	1.230
SRP173429	SRR8316895	Juvenile bud stage	5.172
	SRR8316896	Juvenile bud stage	6.788
	SRR8316897	Juvenile bud stage	3.902
	SRR8316894	Third green stage	0.869
	SRR8316900	Third green stage	1.808
	SRR8316901	Third green stage	0.824
	SRR8316898	Complete white stage	0.418
	SRR8316899	Complete white stage	5.156
	SRR8316903	Complete white stage	2.481
	SRR8316902	Silver flowering stage	0.113
	SRR8316904	Silver flowering stage	0.059
	SRR8316905	Silver flowering stage	0.144
	SRR8316906	Gold flowering stage	1.357
	SRR8316907	Gold flowering stage	0.944
	SRR8316908	Gold flowering stage	0.764
SRP132670	SRR6706286	Control	0.129
	SRR6706287	Light intensity 50%	0.426
	SRR6706288	Light intensity 20%	0.374
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.636
	CNS0095593	Slightly white alabastrum(diploid) 2	4.735
	CNS0095594	Slightly white alabastrum(diploid) 3	6.932
	CNS0095595	Whole white alabastrum(diploid) 2	5.267
	CNS0095596	Whole white alabastrum(diploid) 3	0.250
	CNS0095597	Whole white alabastrum(diploid) 4	2.810
	CNS0095598	Silvery flower (diploied) 1	19.453
	CNS0095599	Silvery flower (diploied) 2	11.466
	CNS0095600	Silvery flower (diploied) 3	3.934
	CNS0095601	Golden flower (diploid) 1	15.965
	CNS0095602	Golden flower (diploid) 2	8.155
	CNS0095603	Golden flower (diploid) 3	9.695
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.793
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.386
	CNS0095606	Slightly white alabastrum(tetraploid) 3	8.387
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.834
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.081
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.354
	CNS0095610	Silvery flower (tetraploid) 1	0.286
	CNS0095611	Silvery flower (tetraploid) 2	3.931
	CNS0095612	Silvery flower (tetraploid) 3	0.658
	CNS0095613	Golden flower (tetraploid) 1	0.354
	CNS0095614	Golden flower (tetraploid) 2	0.434
	CNS0095615	Golden flower (tetraploid) 3	0.097
CRA001975	CRR073297	Stem 1	1.116
	CRR073298	Stem 2	1.825
	CRR073299	Stem 3	1.379
	CRR073300	Leaf 1	0.416
	CRR073301	Leaf 2	0.517
	CRR073302	Leaf 3	0.260
	CRR073303	Juvenile bud 1	0.299
	CRR073304	Juvenile bud 2	0.128
	CRR073305	Juvenile bud 3	0.383
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.730
	CRR073314	Silver flowering 3	0.145
	CRR073315	Gold flowering 1	6.301
	CRR073316	Gold flowering 2	16.853
	CRR073317	Gold flowering 3	2.429
	CRR073318	Tawny withering 1	11.162
	CRR073319	Tawny withering 2	10.835
	CRR073320	Tawny withering 3	6.858