Gene detail

Detail information of GWHGAAZE001899

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009388075.1	1.4658E-45	PREDICTED: beta-hexosaminidase 3-like [Musa acuminata subsp. malaccensis]
Swissprot	tr\|Q8L7S6\|HEXO3_ARATH	2E-34	Beta-hexosaminidase 3 (Precursor)
trEMBL	tr\|M0UDD1\|M0UDD1_MUSAM	1E-45	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GSMUA_AchrUn_randomP29240_001} (Fragment)
TAIR10	AT1G65590.1	7E-30	beta-hexosaminidase 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	64001335	64003052	+
GWHAAZE00000001	mRNA	64001335	64003052	+
GWHAAZE00000001	exon	64001335	64001413	+
GWHAAZE00000001	exon	64002733	64003052	+
GWHAAZE00000001	CDS	64001335	64001413	+
GWHAAZE00000001	CDS	64002733	64003052	+

Transcript Sequence
>GWHTAAZE001903 ATGCTTCATCTTTGCTGCAAGGAGGAGACCTTTAACAACTTTGGCAGTAAATTGAGCCCAAAACAGTGGTACATAACTGCAAATGCTTTTAACTCTATTTTTGCTCTGAACCACGACAGGCTAGGGAGTGGTGTTGCCAAGAAGGTGACGGAAGCTGGATTGAGTTGCATAGTAAGTAACCAGGATAAGTGGTACTTGGACCACTTGGATGCCACGTGGTGGGATTTCTATATGAATGAACCCCTCACAAATATCACAGAACCAGAACACCAGAAGTTAGTTATTGGGGGTGAGGTGTGTATGTGGGGTGGAAACATTGATGGCTCTGATATTGAACAAACAATTTGGCCCCCGCGCTGCTGCTGCCGGAGGTACTCATTTATATATTCTAGGCCCTGA

Network for GWHGAAZE001899

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00728.23	Glyco_hydro_20	43	117	4.20E-07
PF04601.14	DUF569	1	143	3.20E-60
PF04601.14	DUF569	207	350	8.70E-70

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12373	HEXA_B	Metabolic pathways	map01100
		Amino sugar and nucleotide sugar metabolism	map00520
		Various types of N-glycan biosynthesis	map00513
		Glycosaminoglycan degradation	map00531
		Glycosphingolipid biosynthesis - globo and isoglobo series	map00603
		Glycosphingolipid biosynthesis - ganglio series	map00604
		Other glycan degradation	map00511
		Lysosome	map04142

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0004553	molecular_function	hydrolase activity, hydrolyzing O-glycosyl compounds

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.180
	SRR3591706	second leaf	0.074
	SRR3591707	mature leaf	0.216
	SRR3591708	Shoot apex	0.142
	SRR3591709	Stem	0.310
	SRR3591710	White floral bud	1.711
	SRR3591711	White flower	0.261
	SRR3591712	Green floral bud	3.410
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.055
	SRR8316896	Juvenile bud stage	0.378
	SRR8316897	Juvenile bud stage	0.426
	SRR8316894	Third green stage	0.215
	SRR8316900	Third green stage	0.378
	SRR8316901	Third green stage	0.670
	SRR8316898	Complete white stage	0.054
	SRR8316899	Complete white stage	0.213
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.084
	SRR8316904	Silver flowering stage	0.101
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.688
SRP132670	SRR6706286	Control	0.048
	SRR6706287	Light intensity 50%	0.035
	SRR6706288	Light intensity 20%	0.060
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.088
	CNS0095593	Slightly white alabastrum(diploid) 2	0.009
	CNS0095594	Slightly white alabastrum(diploid) 3	0.370
	CNS0095595	Whole white alabastrum(diploid) 2	0.149
	CNS0095596	Whole white alabastrum(diploid) 3	0.121
	CNS0095597	Whole white alabastrum(diploid) 4	0.165
	CNS0095598	Silvery flower (diploied) 1	0.029
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.065
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.191
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.343
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.199
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.210
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.245
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.315
	CRR073298	Stem 2	0.012
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.125
	CRR073301	Leaf 2	0.057
	CRR073302	Leaf 3	0.033
	CRR073303	Juvenile bud 1	0.058
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.011
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.039
	CRR073316	Gold flowering 2	0.064
	CRR073317	Gold flowering 3	0.089
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.050