Gene detail

Detail information of GWHGAAZE001912

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AFO67228.1	1.88002E-31	putative cytochrome P450 72A, partial [Aralia elata]
Swissprot	tr\|H2DH21\|C7A29_PANGI	8E-29	Cytochrome P450 CYP72A219
trEMBL	tr\|I7DCH4\|I7DCH4_ARAEL	7E-32	Putative cytochrome P450 72A {ECO:0000313\|EMBL:AFO67228.1} (Fragment)
TAIR10	AT3G14660.1	5E-19	cytochrome P450, family 72, subfamily A, polypeptide 13

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	64511594	64514244	+
GWHAAZE00000001	mRNA	64511594	64514244	+
GWHAAZE00000001	exon	64511594	64511768	+
GWHAAZE00000001	exon	64514123	64514244	+
GWHAAZE00000001	CDS	64511594	64511768	+
GWHAAZE00000001	CDS	64514123	64514244	+

Transcript Sequence
>GWHTAAZE001916 ATGGAGGTGCACCTCAGAGCCCAAGGTCTCAATGGAAATCCCTACAGGCTACTGGTTGGAGATGTCAAAGAGATCGCCCTTATGAGAAAAGAAGCAATCGTCAACCCCATAAATTTATCCGACGACGTCGTTCCACACCTCATCCCTTTTGTCCACAACTCCTTCCAAAAATATGGTAAGAATTTTTTTGTATGGCTTGGACCAAGACCAATGGTGCATATAATGGACCCTGATGTAATAAAGGAGCTGTTAACTATGATATCTGCTTCCGCCTACTTACATTTTATAGTAGTATAG

Network for GWHGAAZE001912

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF17123.6	zf-RING_11	143	172	1.50E-09
PF13519.7	VWA_2	349	455	7.50E-16

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	RING
Ubiquitin Family	U-box

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.073
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.139
	SRR3591710	White floral bud	0.850
	SRR3591711	White flower	0.573
	SRR3591712	Green floral bud	0.183
	SRR3591713	Yellow flower	0.102
SRP173429	SRR8316895	Juvenile bud stage	0.335
	SRR8316896	Juvenile bud stage	0.433
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.157
	SRR8316900	Third green stage	0.244
	SRR8316901	Third green stage	0.076
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.267
	SRR8316903	Complete white stage	0.465
	SRR8316902	Silver flowering stage	1.750
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.462
	SRR8316906	Gold flowering stage	1.067
	SRR8316907	Gold flowering stage	1.258
	SRR8316908	Gold flowering stage	1.026
SRP132670	SRR6706286	Control	0.965
	SRR6706287	Light intensity 50%	0.564
	SRR6706288	Light intensity 20%	0.614
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.474
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.044
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.024
	CNS0095598	Silvery flower (diploied) 1	0.995
	CNS0095599	Silvery flower (diploied) 2	0.102
	CNS0095600	Silvery flower (diploied) 3	3.618
	CNS0095601	Golden flower (diploid) 1	0.473
	CNS0095602	Golden flower (diploid) 2	6.865
	CNS0095603	Golden flower (diploid) 3	6.348
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.163
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.166
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.205
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.401
	CNS0095610	Silvery flower (tetraploid) 1	5.801
	CNS0095611	Silvery flower (tetraploid) 2	4.664
	CNS0095612	Silvery flower (tetraploid) 3	4.213
	CNS0095613	Golden flower (tetraploid) 1	4.035
	CNS0095614	Golden flower (tetraploid) 2	4.989
	CNS0095615	Golden flower (tetraploid) 3	22.942
CRA001975	CRR073297	Stem 1	0.719
	CRR073298	Stem 2	0.600
	CRR073299	Stem 3	0.889
	CRR073300	Leaf 1	0.646
	CRR073301	Leaf 2	0.152
	CRR073302	Leaf 3	0.135
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.505
	CRR073305	Juvenile bud 3	0.697
	CRR073306	Third green 1	1.291
	CRR073307	Third green 2	3.059
	CRR073308	Third green 3	0.777
	CRR073309	Second white 1	0.681
	CRR073310	Second white 2	1.497
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.112
	CRR073313	Silver flowering 2	0.272
	CRR073314	Silver flowering 3	0.068
	CRR073315	Gold flowering 1	0.618
	CRR073316	Gold flowering 2	2.341
	CRR073317	Gold flowering 3	1.066
	CRR073318	Tawny withering 1	8.704
	CRR073319	Tawny withering 2	5.366
	CRR073320	Tawny withering 3	2.481