Gene detail

Detail information of GWHGAAZE001924

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011077093.1	1.75628E-47	PREDICTED: beta-hexosaminidase 3 [Sesamum indicum]
Swissprot	tr\|Q8L7S6\|HEXO3_ARATH	1E-38	Beta-hexosaminidase 3 (Precursor)
trEMBL	tr\|A0A096RZH0\|A0A096RZH0_MAIZE	7E-47	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GRMZM2G121514_P03} (Fragment)
TAIR10	AT1G65590.1	2E-33	beta-hexosaminidase 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	64848899	64850807	-
GWHAAZE00000001	mRNA	64848899	64850807	-
GWHAAZE00000001	exon	64848899	64849065	-
GWHAAZE00000001	exon	64850432	64850601	-
GWHAAZE00000001	exon	64850803	64850807	-
GWHAAZE00000001	CDS	64850803	64850807	-
GWHAAZE00000001	CDS	64850432	64850601	-
GWHAAZE00000001	CDS	64848899	64849065	-

Transcript Sequence
>GWHTAAZE001928 ATGAGGCTAGGGAGTGGTGTTGCCAAGAAGGTGACGGAAGCTGGATTGAGTTGCATAGTAAGTAACCAGGATAAGTGGTACTTGGACCACTTGGATGCCACGTGGTGGGATTTCTATATGAATGAACCCCTCACAAATATCACAGAACCAGAACACCAGAAGTTAGTTATTGGGGAGAGGCTGTGGACAACACCTGAGAAACTAGCAAAGGAACCCGCGGAACTAACGAAAAGACTAACACACTTTAGGTGTTTATTGAACCAAAGAGGAGTTGCCGCTGCTCCTCTAGAAGGCCTTGGTCGAGATGCTCCGGTACAGCCGGGCTCCTGCTATGTTCAGTAG

Network for GWHGAAZE001924

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00413.25	Peptidase_M10	56	213	7.50E-35

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12373	HEXA_B	Metabolic pathways	map01100
		Amino sugar and nucleotide sugar metabolism	map00520
		Various types of N-glycan biosynthesis	map00513
		Glycosaminoglycan degradation	map00531
		Glycosphingolipid biosynthesis - globo and isoglobo series	map00603
		Glycosphingolipid biosynthesis - ganglio series	map00604
		Other glycan degradation	map00511
		Lysosome	map04142

Gene Ontology

GO term	Ontology	Name
GO:0006508	biological_process	proteolysis
GO:0031012	cellular_component	extracellular matrix
GO:0004222	molecular_function	metalloendopeptidase activity
GO:0008270	molecular_function	zinc ion binding
GO:0008237	molecular_function	metallopeptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.139
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	1.636
	SRR3591711	White flower	0.288
	SRR3591712	Green floral bud	3.960
	SRR3591713	Yellow flower	0.225
SRP173429	SRR8316895	Juvenile bud stage	0.044
	SRR8316896	Juvenile bud stage	0.239
	SRR8316897	Juvenile bud stage	0.297
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.106
	SRR8316901	Third green stage	0.221
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.326
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.058
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.134
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.429
SRP132670	SRR6706286	Control	0.128
	SRR6706287	Light intensity 50%	0.079
	SRR6706288	Light intensity 20%	0.037
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.272
	CNS0095593	Slightly white alabastrum(diploid) 2	0.168
	CNS0095594	Slightly white alabastrum(diploid) 3	0.387
	CNS0095595	Whole white alabastrum(diploid) 2	0.025
	CNS0095596	Whole white alabastrum(diploid) 3	0.939
	CNS0095597	Whole white alabastrum(diploid) 4	0.469
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.161
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.312
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.433
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.005
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.125
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.108
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.118
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.090
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.572
	CRR073298	Stem 2	0.014
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.060
	CRR073301	Leaf 2	0.186
	CRR073302	Leaf 3	0.033
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.183
	CRR073306	Third green 1	0.080
	CRR073307	Third green 2	0.262
	CRR073308	Third green 3	0.108
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.034
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.153
	CRR073316	Gold flowering 2	0.044
	CRR073317	Gold flowering 3	0.079
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.026
	CRR073320	Tawny withering 3	0.000