Gene detail

Detail information of GWHGAAZE002054

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006348870.1	1.05997E-91	PREDICTED: uncharacterized protein LOC102600485 [Solanum tuberosum]
Swissprot	tr\|Q9S7R3\|LSH10_ARATH	4E-81	Protein LIGHT-DEPENDENT SHORT HYPOCOTYLS 10
trEMBL	tr\|M1BTS7\|M1BTS7_SOLTU	4E-92	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400052658}
TAIR10	AT2G42610.2	1E-58	Protein of unknown function (DUF640)

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	68167311	68167805	+
GWHAAZE00000001	mRNA	68167311	68167805	+
GWHAAZE00000001	exon	68167311	68167805	+
GWHAAZE00000001	CDS	68167311	68167805	+

Transcript Sequence
>GWHTAAZE002058 ATGGAGAAAGGGAAAGATTCGGCGGAAGGGTCGTCGAGGTACTCCGGTGACTCTCCGGTAACACCAAGTCGGTATGAGTCACAAAAGAGGAGAGATTGGAACACTTTTGGGCAGTACTTGAGGAACCAAAGCCCACCACTTTCACCATCCAGTTGTAATAGCAACCACGTGATTGAGTTCCTTAGGTACTTAGACCAATTTGGAAAGACTAAAGTTCATACACTAGATTGTATTTTCTATGGCCAGCCTGAGCCACCGGCTCCGTGCTCGTGCGCACTGAGGCAGGCTTGGGGCAGCCTTGATGCACTCATCGGCCGGCTAAGAGCAGCCTATGAAGAGAACGGTGGTACACCGGAGACTAACCCTTTTGCAAGCAGCACTATTCGTGTTTATCTTAGAGATGTGAAGGAGTGTCAAGCAAAGGCGAGGGGTATTCCATACAAGAAAAAGAAGAAGATAACAAGCCAAAGCAAGGGAGATGCTGAATCGAATTAG

Network for GWHGAAZE002054

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF12937.8	F-box-like	3	39	2.30E-08
PF07734.14	FBA_1	205	298	6.80E-09
PF04852.13	DUF640	17	137	3.20E-61

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	F-box

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	17.242
	SRR3591706	second leaf	0.501
	SRR3591707	mature leaf	0.168
	SRR3591708	Shoot apex	7.955
	SRR3591709	Stem	21.984
	SRR3591710	White floral bud	2.210
	SRR3591711	White flower	3.083
	SRR3591712	Green floral bud	0.356
	SRR3591713	Yellow flower	0.686
SRP173429	SRR8316895	Juvenile bud stage	0.771
	SRR8316896	Juvenile bud stage	0.445
	SRR8316897	Juvenile bud stage	0.337
	SRR8316894	Third green stage	1.583
	SRR8316900	Third green stage	2.565
	SRR8316901	Third green stage	2.616
	SRR8316898	Complete white stage	1.729
	SRR8316899	Complete white stage	9.883
	SRR8316903	Complete white stage	2.540
	SRR8316902	Silver flowering stage	0.139
	SRR8316904	Silver flowering stage	0.468
	SRR8316905	Silver flowering stage	0.035
	SRR8316906	Gold flowering stage	0.216
	SRR8316907	Gold flowering stage	0.071
	SRR8316908	Gold flowering stage	0.625
SRP132670	SRR6706286	Control	4.998
	SRR6706287	Light intensity 50%	5.988
	SRR6706288	Light intensity 20%	5.903
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.759
	CNS0095593	Slightly white alabastrum(diploid) 2	5.470
	CNS0095594	Slightly white alabastrum(diploid) 3	1.066
	CNS0095595	Whole white alabastrum(diploid) 2	3.809
	CNS0095596	Whole white alabastrum(diploid) 3	0.784
	CNS0095597	Whole white alabastrum(diploid) 4	2.023
	CNS0095598	Silvery flower (diploied) 1	5.855
	CNS0095599	Silvery flower (diploied) 2	5.870
	CNS0095600	Silvery flower (diploied) 3	2.038
	CNS0095601	Golden flower (diploid) 1	4.628
	CNS0095602	Golden flower (diploid) 2	3.256
	CNS0095603	Golden flower (diploid) 3	2.440
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.470
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.944
	CNS0095606	Slightly white alabastrum(tetraploid) 3	5.601
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.856
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.284
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.273
	CNS0095610	Silvery flower (tetraploid) 1	2.452
	CNS0095611	Silvery flower (tetraploid) 2	1.166
	CNS0095612	Silvery flower (tetraploid) 3	0.687
	CNS0095613	Golden flower (tetraploid) 1	0.771
	CNS0095614	Golden flower (tetraploid) 2	0.537
	CNS0095615	Golden flower (tetraploid) 3	0.326
CRA001975	CRR073297	Stem 1	1.516
	CRR073298	Stem 2	1.357
	CRR073299	Stem 3	1.181
	CRR073300	Leaf 1	3.559
	CRR073301	Leaf 2	4.418
	CRR073302	Leaf 3	4.198
	CRR073303	Juvenile bud 1	3.150
	CRR073304	Juvenile bud 2	2.640
	CRR073305	Juvenile bud 3	3.647
	CRR073306	Third green 1	0.046
	CRR073307	Third green 2	0.142
	CRR073308	Third green 3	0.056
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.160
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.051
	CRR073315	Gold flowering 1	0.466
	CRR073316	Gold flowering 2	0.261
	CRR073317	Gold flowering 3	0.566
	CRR073318	Tawny withering 1	24.823
	CRR073319	Tawny withering 2	25.312
	CRR073320	Tawny withering 3	26.518