Gene detail

Detail information of GWHGAAZE002074

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002326022.1	3.68918E-42	hypothetical protein POPTR_0019s12020g [Populus trichocarpa]
trEMBL	tr\|B9IQQ0\|B9IQQ0_POPTR	1E-42	Uncharacterized protein {ECO:0000313\|EMBL:EEF00404.1}
TAIR10	AT2G31090.1	2E-11	Without detailed annotation

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	68664549	68665573	-
GWHAAZE00000001	mRNA	68664549	68665573	-
GWHAAZE00000001	exon	68665464	68665573	-
GWHAAZE00000001	exon	68664549	68664912	-
GWHAAZE00000001	CDS	68665464	68665573	-
GWHAAZE00000001	CDS	68664789	68664912	-
GWHAAZE00000001	three_prime_UTR	68664549	68664788	-

Transcript Sequence
>GWHTAAZE002078 ATGTGCTGCGGAGACGGAGATTGCAGGCCTTTAGGCTTTTTACTGGGCTTGCCCTTCGCCTTCCTCTCCCTCCTCATCTCCATCGTCGGAATTGTCGTCTGGATCGTAGGGTTGTTGTTGAGTTGCATATGTCCGTGTTGCTTTTGCGTGACGGTGTTAGTGGAGCTGGCACTGGAGTTGATCAAAGCCCCTCTTCATGTCATGGAGTGGTTTACCTCTCAGATTCCCTGTTAATACCTTAAATATGTAATTATTTCCCCTCTCTCTTCCCATTCAATATTAATCCTTTGTGTAATTTATTGTGTTTAGCGTTTGATTTCACTGTACTTTTAGATGCAATTAAACAAATGCTGATTAGTTTTTTCTATGTAATTCTTACTCTAGAAAATCGATTTAACATATAGCTATAATTGTCTTGATATTTGTGCAATATTAAACTTTGTAAAATGAATAGGCTGTATCTATCGCCAAAAC

Network for GWHGAAZE002074

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0261

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05695.13	DUF825	1	96	7.70E-57
PF05695.13	DUF825	94	358	1.60E-171

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0009507	cellular_component	chloroplast
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	40.765
	SRR3591706	second leaf	12.608
	SRR3591707	mature leaf	16.384
	SRR3591708	Shoot apex	16.904
	SRR3591709	Stem	49.066
	SRR3591710	White floral bud	16.014
	SRR3591711	White flower	12.609
	SRR3591712	Green floral bud	7.997
	SRR3591713	Yellow flower	3.046
SRP173429	SRR8316895	Juvenile bud stage	10.925
	SRR8316896	Juvenile bud stage	12.599
	SRR8316897	Juvenile bud stage	12.191
	SRR8316894	Third green stage	2.000
	SRR8316900	Third green stage	4.906
	SRR8316901	Third green stage	9.513
	SRR8316898	Complete white stage	5.546
	SRR8316899	Complete white stage	20.560
	SRR8316903	Complete white stage	9.016
	SRR8316902	Silver flowering stage	2.488
	SRR8316904	Silver flowering stage	1.755
	SRR8316905	Silver flowering stage	1.759
	SRR8316906	Gold flowering stage	8.329
	SRR8316907	Gold flowering stage	5.277
	SRR8316908	Gold flowering stage	4.154
SRP132670	SRR6706286	Control	5.019
	SRR6706287	Light intensity 50%	4.493
	SRR6706288	Light intensity 20%	3.697
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	13.393
	CNS0095593	Slightly white alabastrum(diploid) 2	13.652
	CNS0095594	Slightly white alabastrum(diploid) 3	15.152
	CNS0095595	Whole white alabastrum(diploid) 2	11.141
	CNS0095596	Whole white alabastrum(diploid) 3	4.871
	CNS0095597	Whole white alabastrum(diploid) 4	6.445
	CNS0095598	Silvery flower (diploied) 1	35.046
	CNS0095599	Silvery flower (diploied) 2	22.653
	CNS0095600	Silvery flower (diploied) 3	10.812
	CNS0095601	Golden flower (diploid) 1	33.456
	CNS0095602	Golden flower (diploid) 2	20.795
	CNS0095603	Golden flower (diploid) 3	16.250
	CNS0095604	Slightly white alabastrum(tetraploid) 1	8.630
	CNS0095605	Slightly white alabastrum(tetraploid) 2	9.188
	CNS0095606	Slightly white alabastrum(tetraploid) 3	17.289
	CNS0095607	Whole white alabastrum(tetraploid) 1	6.295
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.550
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.443
	CNS0095610	Silvery flower (tetraploid) 1	6.292
	CNS0095611	Silvery flower (tetraploid) 2	4.404
	CNS0095612	Silvery flower (tetraploid) 3	3.984
	CNS0095613	Golden flower (tetraploid) 1	5.971
	CNS0095614	Golden flower (tetraploid) 2	5.541
	CNS0095615	Golden flower (tetraploid) 3	3.646
CRA001975	CRR073297	Stem 1	19.999
	CRR073298	Stem 2	16.744
	CRR073299	Stem 3	21.549
	CRR073300	Leaf 1	13.863
	CRR073301	Leaf 2	18.816
	CRR073302	Leaf 3	13.302
	CRR073303	Juvenile bud 1	13.997
	CRR073304	Juvenile bud 2	18.770
	CRR073305	Juvenile bud 3	20.358
	CRR073306	Third green 1	7.079
	CRR073307	Third green 2	11.637
	CRR073308	Third green 3	9.458
	CRR073309	Second white 1	1.237
	CRR073310	Second white 2	2.040
	CRR073311	Second white 3	1.489
	CRR073312	Silver flowering 1	3.081
	CRR073313	Silver flowering 2	0.243
	CRR073314	Silver flowering 3	1.522
	CRR073315	Gold flowering 1	47.150
	CRR073316	Gold flowering 2	42.957
	CRR073317	Gold flowering 3	39.254
	CRR073318	Tawny withering 1	41.378
	CRR073319	Tawny withering 2	58.704
	CRR073320	Tawny withering 3	36.995