Gene detail

Detail information of GWHGAAZE002086

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002326022.1	3.68918E-42	hypothetical protein POPTR_0019s12020g [Populus trichocarpa]
trEMBL	tr\|B9IQQ0\|B9IQQ0_POPTR	1E-42	Uncharacterized protein {ECO:0000313\|EMBL:EEF00404.1}
TAIR10	AT2G31090.1	2E-11	Without detailed annotation

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	68892530	68893556	-
GWHAAZE00000001	mRNA	68892530	68893556	-
GWHAAZE00000001	exon	68893447	68893556	-
GWHAAZE00000001	exon	68892530	68892893	-
GWHAAZE00000001	CDS	68893447	68893556	-
GWHAAZE00000001	CDS	68892770	68892893	-
GWHAAZE00000001	three_prime_UTR	68892530	68892769	-

Transcript Sequence
>GWHTAAZE002090 ATGTGCTGCGGAGACGGAGATTGCAGGCCTTTAGGCTTTTTACTGGGCTTGCCCTTCGCCTTCCTCTCCCTCCTCATCTCCATCGTCGGAATTGTCGTCTGGATCGTAGGGTTGTTGTTGAGTTGCATATGTCCGTGTTGCTTTTGCGTGACGGTGTTAGTGGAGCTGGCACTGGAGTTGATCAAAGCCCCTCTTCATGTCATGGAGTGGTTTACCTCTCAGATTCCCTGTTAATACCTTAAATATGTAATTATTTCCCCTCTTTCTTCCCATTCAATATTAATCCTTTGTGTAATTTATTGTGTTTAGCGTTTGATTTCACTGTACTTTTAGATGCAATTAAACAAATGCTGATTAGTTTTTTCTATGTAATTCTTACTCTAGAAAATCGATTTAACATATAGCTATAATTGTCTTGATATTTGTGCAATATTAAACTTTGTAAAATGAATAGGCTGTATCTATCGCCAAAAC

Network for GWHGAAZE002086

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0261

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00762.20	Ferrochelatase	169	381	1.10E-66

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01772	hemH, FECH	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Porphyrin and chlorophyll metabolism	map00860

Gene Ontology

GO term	Ontology	Name
GO:0006783	biological_process	heme biosynthetic process
GO:0004325	molecular_function	ferrochelatase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	35.008
	SRR3591706	second leaf	9.920
	SRR3591707	mature leaf	13.578
	SRR3591708	Shoot apex	13.235
	SRR3591709	Stem	39.913
	SRR3591710	White floral bud	17.938
	SRR3591711	White flower	11.501
	SRR3591712	Green floral bud	8.186
	SRR3591713	Yellow flower	3.314
SRP173429	SRR8316895	Juvenile bud stage	11.176
	SRR8316896	Juvenile bud stage	14.105
	SRR8316897	Juvenile bud stage	7.987
	SRR8316894	Third green stage	1.780
	SRR8316900	Third green stage	4.607
	SRR8316901	Third green stage	8.853
	SRR8316898	Complete white stage	4.327
	SRR8316899	Complete white stage	17.214
	SRR8316903	Complete white stage	8.993
	SRR8316902	Silver flowering stage	2.408
	SRR8316904	Silver flowering stage	1.916
	SRR8316905	Silver flowering stage	1.426
	SRR8316906	Gold flowering stage	6.455
	SRR8316907	Gold flowering stage	4.598
	SRR8316908	Gold flowering stage	2.908
SRP132670	SRR6706286	Control	4.078
	SRR6706287	Light intensity 50%	3.727
	SRR6706288	Light intensity 20%	3.093
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	19.499
	CNS0095593	Slightly white alabastrum(diploid) 2	12.452
	CNS0095594	Slightly white alabastrum(diploid) 3	17.948
	CNS0095595	Whole white alabastrum(diploid) 2	10.292
	CNS0095596	Whole white alabastrum(diploid) 3	4.933
	CNS0095597	Whole white alabastrum(diploid) 4	6.534
	CNS0095598	Silvery flower (diploied) 1	37.314
	CNS0095599	Silvery flower (diploied) 2	21.156
	CNS0095600	Silvery flower (diploied) 3	9.705
	CNS0095601	Golden flower (diploid) 1	29.745
	CNS0095602	Golden flower (diploid) 2	19.720
	CNS0095603	Golden flower (diploid) 3	16.984
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.044
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.553
	CNS0095606	Slightly white alabastrum(tetraploid) 3	10.724
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.828
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.526
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.121
	CNS0095610	Silvery flower (tetraploid) 1	4.095
	CNS0095611	Silvery flower (tetraploid) 2	1.910
	CNS0095612	Silvery flower (tetraploid) 3	2.036
	CNS0095613	Golden flower (tetraploid) 1	3.894
	CNS0095614	Golden flower (tetraploid) 2	3.350
	CNS0095615	Golden flower (tetraploid) 3	1.841
CRA001975	CRR073297	Stem 1	18.014
	CRR073298	Stem 2	18.614
	CRR073299	Stem 3	22.277
	CRR073300	Leaf 1	14.582
	CRR073301	Leaf 2	18.555
	CRR073302	Leaf 3	12.661
	CRR073303	Juvenile bud 1	15.790
	CRR073304	Juvenile bud 2	19.375
	CRR073305	Juvenile bud 3	19.446
	CRR073306	Third green 1	7.256
	CRR073307	Third green 2	13.946
	CRR073308	Third green 3	8.514
	CRR073309	Second white 1	2.605
	CRR073310	Second white 2	2.894
	CRR073311	Second white 3	1.237
	CRR073312	Silver flowering 1	0.900
	CRR073313	Silver flowering 2	1.651
	CRR073314	Silver flowering 3	1.765
	CRR073315	Gold flowering 1	49.481
	CRR073316	Gold flowering 2	39.985
	CRR073317	Gold flowering 3	34.712
	CRR073318	Tawny withering 1	38.888
	CRR073319	Tawny withering 2	53.671
	CRR073320	Tawny withering 3	31.583