Gene detail

Detail information of GWHGAAZE002126

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002313084.2	3.12039E-52	hypothetical protein POPTR_0009s11040g [Populus trichocarpa]
COG	YP_004688377.1	2E-19	alpha/beta hydrolase
Swissprot	tr\|Q8S8S9\|MES1_ARATH	7E-44	Methylesterase 1
trEMBL	tr\|B9HRV7\|B9HRV7_POPTR	1E-52	Uncharacterized protein {ECO:0000313\|EMBL:EEE87039.2}
TAIR10	AT2G23620.1	1E-36	methyl esterase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	70084836	70085780	+
GWHAAZE00000001	mRNA	70084836	70085780	+
GWHAAZE00000001	exon	70084836	70085243	+
GWHAAZE00000001	exon	70085643	70085780	+
GWHAAZE00000001	CDS	70084836	70085243	+
GWHAAZE00000001	CDS	70085643	70085780	+

Transcript Sequence
>GWHTAAZE002130 ATGGATTTAAAAAAGAAAATTTGTTCTGGTTTAAAACATATATGTGCAACTAGAATTCATTTTGTACTAGTGCATGGAGCTGGCCACGGAGGATGGTGCTGGTACAAGGTGGCAAATCTACTAGAGTCCGCTGGCCACACCGTAACTGCAGTGGATCTTGGCGCGTCGGGGAGTAACCCAAAACAATTGTCGGATATTCCCACATACTCCGGCTATCTACAGCCGCTCGCGGATGTCTTGGAAGCTCTACCGTGCGGTCAGAAGGTGGCTCTGGTGGGTCATAGCATGGGAGGAGTAACCATTTCTGTTGCTATGGAGATGTTCCCTTCAAAAATTGCTATTGCAATTTATTGTACTGCTGTTATGCCCACACCTGATAATTTTGATCTTCTTCAACTCAATAAACAGTATTTCACTAATATTCCATTTTTTGGGGATAGCAAATTTATTTTTGATTCATGTGGAGCTGCAACTGCCGTTTATTTTGGTCCAAATTACTTGGCAACCACGTTGTATCAACTTTCCCCTCATGAGGTATGGTTGTAA

Network for GWHGAAZE002126

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF12697.8	Abhydrolase_6	21	143	2.60E-16
PF00320.28	GATA	156	186	4.40E-13

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C2C2-GATA

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0008270	molecular_function	zinc ion binding
GO:0043565	molecular_function	sequence-specific DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	35.858
	SRR3591706	second leaf	12.702
	SRR3591707	mature leaf	23.630
	SRR3591708	Shoot apex	7.468
	SRR3591709	Stem	162.129
	SRR3591710	White floral bud	21.330
	SRR3591711	White flower	52.703
	SRR3591712	Green floral bud	11.673
	SRR3591713	Yellow flower	6.902
SRP173429	SRR8316895	Juvenile bud stage	1.540
	SRR8316896	Juvenile bud stage	1.026
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	1.971
	SRR8316900	Third green stage	4.634
	SRR8316901	Third green stage	2.793
	SRR8316898	Complete white stage	8.740
	SRR8316899	Complete white stage	27.042
	SRR8316903	Complete white stage	15.010
	SRR8316902	Silver flowering stage	19.098
	SRR8316904	Silver flowering stage	13.708
	SRR8316905	Silver flowering stage	3.676
	SRR8316906	Gold flowering stage	43.722
	SRR8316907	Gold flowering stage	41.054
	SRR8316908	Gold flowering stage	11.993
SRP132670	SRR6706286	Control	4.270
	SRR6706287	Light intensity 50%	2.985
	SRR6706288	Light intensity 20%	2.876
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	12.873
	CNS0095593	Slightly white alabastrum(diploid) 2	22.185
	CNS0095594	Slightly white alabastrum(diploid) 3	13.305
	CNS0095595	Whole white alabastrum(diploid) 2	21.712
	CNS0095596	Whole white alabastrum(diploid) 3	7.226
	CNS0095597	Whole white alabastrum(diploid) 4	16.973
	CNS0095598	Silvery flower (diploied) 1	21.176
	CNS0095599	Silvery flower (diploied) 2	51.292
	CNS0095600	Silvery flower (diploied) 3	39.339
	CNS0095601	Golden flower (diploid) 1	19.192
	CNS0095602	Golden flower (diploid) 2	41.062
	CNS0095603	Golden flower (diploid) 3	36.390
	CNS0095604	Slightly white alabastrum(tetraploid) 1	16.486
	CNS0095605	Slightly white alabastrum(tetraploid) 2	20.920
	CNS0095606	Slightly white alabastrum(tetraploid) 3	14.377
	CNS0095607	Whole white alabastrum(tetraploid) 1	34.701
	CNS0095608	Whole white alabastrum(tetraploid) 2	31.037
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.979
	CNS0095610	Silvery flower (tetraploid) 1	91.819
	CNS0095611	Silvery flower (tetraploid) 2	21.016
	CNS0095612	Silvery flower (tetraploid) 3	31.511
	CNS0095613	Golden flower (tetraploid) 1	64.133
	CNS0095614	Golden flower (tetraploid) 2	51.833
	CNS0095615	Golden flower (tetraploid) 3	25.143
CRA001975	CRR073297	Stem 1	1.126
	CRR073298	Stem 2	0.953
	CRR073299	Stem 3	1.404
	CRR073300	Leaf 1	3.665
	CRR073301	Leaf 2	5.377
	CRR073302	Leaf 3	7.908
	CRR073303	Juvenile bud 1	21.416
	CRR073304	Juvenile bud 2	9.465
	CRR073305	Juvenile bud 3	8.769
	CRR073306	Third green 1	6.341
	CRR073307	Third green 2	9.208
	CRR073308	Third green 3	9.113
	CRR073309	Second white 1	8.831
	CRR073310	Second white 2	7.885
	CRR073311	Second white 3	4.445
	CRR073312	Silver flowering 1	3.722
	CRR073313	Silver flowering 2	1.098
	CRR073314	Silver flowering 3	0.823
	CRR073315	Gold flowering 1	15.351
	CRR073316	Gold flowering 2	14.871
	CRR073317	Gold flowering 3	13.518
	CRR073318	Tawny withering 1	218.395
	CRR073319	Tawny withering 2	332.962
	CRR073320	Tawny withering 3	249.316