Gene detail

Detail information of GWHGAAZE002131

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006365366.1	1.19175E-54	PREDICTED: salicylic acid-binding protein 2-like [Solanum tuberosum]
COG	YP_004688377.1	3E-18	alpha/beta hydrolase
Swissprot	tr\|Q8S8S9\|MES1_ARATH	6E-48	Methylesterase 1
trEMBL	tr\|M1C3N3\|M1C3N3_SOLTU	3E-56	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400059019}
TAIR10	AT2G23620.1	8E-40	methyl esterase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	70553049	70554196	+
GWHAAZE00000001	mRNA	70553049	70554196	+
GWHAAZE00000001	exon	70553049	70553420	+
GWHAAZE00000001	exon	70554059	70554196	+
GWHAAZE00000001	CDS	70553049	70553420	+
GWHAAZE00000001	CDS	70554059	70554196	+

Transcript Sequence
>GWHTAAZE002135 ATGTCTACTACTAAAAGCATCCATTTTGTACTAGTCCATGGATCTTGCCACGGAGGATGGTGCTGGTACAAGGTGGCAAATCTACTACTGTCCGCTGGCCACACAGTAACTGCGGTGGATCTTGGCGCATCGGGGATTAACCCGAAGCAATTGACGGATATTCCCACATACTCCGGCTATCAACAGCCGCTCACGGACGTCTTCGAATCTCTACCGTCGAATGAGAAGGTTGTTCTCGTGGGCCATAGCATGGGAGGAGTAAACACTTGTGTTGCTATGGAGAAGTTCCCTACAAAAATTGCAGTTGCAATTTTTTGTGCTGCTATTATGCCCACACCTGATAATTTTGATCTTCTTCAACTCAATCAACAGTATTTCTCTGATATTGCATATTATCAGGATAGCAAATTTATATTTGATTCAAGTGGGACCGCAACTGCCATTTATTTTGGTAAAAATTTCTTGCAAACCATGATATATCAACTTTCTCCTCCTGAGGTATGTTTATAA

Network for GWHGAAZE002131

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF12697.8	Abhydrolase_6	9	126	5.70E-14
PF16881.6	LIAS_N	35	126	3.60E-16
PF04055.22	Radical_SAM	149	311	3.20E-11

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03644	lipA, LIAS, LIP1, LIP5	Metabolic pathways	map01100
K03644	lipA, LIAS, LIP1, LIP5	Lipoic acid metabolism	map00785

Gene Ontology

GO term	Ontology	Name
GO:0009107	biological_process	lipoate biosynthetic process
GO:0005739	cellular_component	mitochondrion
GO:0016992	molecular_function	lipoate synthase activity
GO:0051539	molecular_function	4 iron, 4 sulfur cluster binding
GO:0003824	molecular_function	catalytic activity
GO:0051536	molecular_function	iron-sulfur cluster binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.803
	SRR3591711	White flower	0.142
	SRR3591712	Green floral bud	0.314
	SRR3591713	Yellow flower	6.347
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.130
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.007
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	1.010
	SRR8316899	Complete white stage	0.628
	SRR8316903	Complete white stage	0.650
	SRR8316902	Silver flowering stage	0.334
	SRR8316904	Silver flowering stage	0.011
	SRR8316905	Silver flowering stage	0.220
	SRR8316906	Gold flowering stage	0.381
	SRR8316907	Gold flowering stage	1.540
	SRR8316908	Gold flowering stage	0.338
SRP132670	SRR6706286	Control	0.399
	SRR6706287	Light intensity 50%	0.225
	SRR6706288	Light intensity 20%	0.053
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.039
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.009
	CNS0095598	Silvery flower (diploied) 1	1.448
	CNS0095599	Silvery flower (diploied) 2	0.061
	CNS0095600	Silvery flower (diploied) 3	0.439
	CNS0095601	Golden flower (diploid) 1	0.669
	CNS0095602	Golden flower (diploid) 2	6.179
	CNS0095603	Golden flower (diploid) 3	5.248
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.326
	CNS0095611	Silvery flower (tetraploid) 2	0.076
	CNS0095612	Silvery flower (tetraploid) 3	1.132
	CNS0095613	Golden flower (tetraploid) 1	1.059
	CNS0095614	Golden flower (tetraploid) 2	1.720
	CNS0095615	Golden flower (tetraploid) 3	2.597
CRA001975	CRR073297	Stem 1	0.097
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.109
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.899
	CRR073313	Silver flowering 2	0.312
	CRR073314	Silver flowering 3	1.012
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.174
	CRR073318	Tawny withering 1	3.533
	CRR073319	Tawny withering 2	0.682
	CRR073320	Tawny withering 3	3.379