Gene detail

Detail information of GWHGAAZE002155

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP14818.1	2.39041E-14	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9S758\|SPL5_ARATH	1E-15	Squamosa promoter-binding-like protein 5
trEMBL	tr\|A0A068V4M3\|A0A068V4M3_COFCA	9E-15	Coffea canephora DH200=94 genomic scaffold, scaffold_91 {ECO:0000313\|EMBL:CDP14818.1}
TAIR10	AT3G15270.1	1E-12	squamosa promoter binding protein-like 5

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	71276660	71278050	-
GWHAAZE00000001	mRNA	71276660	71278050	-
GWHAAZE00000001	exon	71278022	71278050	-
GWHAAZE00000001	exon	71276660	71277091	-
GWHAAZE00000001	CDS	71278022	71278050	-
GWHAAZE00000001	CDS	71276944	71277091	-
GWHAAZE00000001	three_prime_UTR	71276660	71276943	-

Transcript Sequence
>GWHTAAZE002159 ATGACAAAGAAACAAAATAACTTTGGGTTGTTTCATGAGCTAACGGAATTCGATGAAGCAAAGAGGAGTTGCCGGAGGCGACTGGCCGGACACAACGAGCGTCGGAGGAAAAACTCCGGCGACGCTCAGGTGGAAGGGCCCGGCCAGAGGGGGAGTGGCTGTGGCTGCAACATGTAACCATGTTAAAGGAGATAGTGTGTGGGCTAGTTGATGAGTGGGGGATCGGAGGATTCAAATAACTACTACCCACCATGACAGTAATTCTACTAATTACAAGCATTTCCAAATTAGATGAAGATAAAAAAGCTCTCATAACATATTTATATATATATATAAGCTCTCTCTCTTCTGTCATCTTAGCTATGAGAAATTTATATATCTATGTAGCTATTTATGTATGGATTTTGTACCATGTTTAGGGATTCTATTTTAAAAAAAAAATAACAAAGCAATATAGTATT

Network for GWHGAAZE002155

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03110.15	SBP	10	37	7.60E-10

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	SBP

KEGG pathway

KO	Enzyme	pathway	mapID
K13436	PTI1	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005634	cellular_component	nucleus
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.603
	SRR3591706	second leaf	1.004
	SRR3591707	mature leaf	7.882
	SRR3591708	Shoot apex	0.391
	SRR3591709	Stem	0.249
	SRR3591710	White floral bud	9.705
	SRR3591711	White flower	4.695
	SRR3591712	Green floral bud	31.821
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	9.700
	SRR8316896	Juvenile bud stage	3.510
	SRR8316897	Juvenile bud stage	4.890
	SRR8316894	Third green stage	3.546
	SRR8316900	Third green stage	34.058
	SRR8316901	Third green stage	16.787
	SRR8316898	Complete white stage	1.163
	SRR8316899	Complete white stage	34.739
	SRR8316903	Complete white stage	2.782
	SRR8316902	Silver flowering stage	0.159
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	29.920
	SRR6706287	Light intensity 50%	20.413
	SRR6706288	Light intensity 20%	21.279
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	10.337
	CNS0095593	Slightly white alabastrum(diploid) 2	16.957
	CNS0095594	Slightly white alabastrum(diploid) 3	9.610
	CNS0095595	Whole white alabastrum(diploid) 2	25.713
	CNS0095596	Whole white alabastrum(diploid) 3	34.249
	CNS0095597	Whole white alabastrum(diploid) 4	23.598
	CNS0095598	Silvery flower (diploied) 1	20.103
	CNS0095599	Silvery flower (diploied) 2	30.879
	CNS0095600	Silvery flower (diploied) 3	6.047
	CNS0095601	Golden flower (diploid) 1	29.642
	CNS0095602	Golden flower (diploid) 2	10.697
	CNS0095603	Golden flower (diploid) 3	10.407
	CNS0095604	Slightly white alabastrum(tetraploid) 1	9.704
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.702
	CNS0095606	Slightly white alabastrum(tetraploid) 3	10.442
	CNS0095607	Whole white alabastrum(tetraploid) 1	7.292
	CNS0095608	Whole white alabastrum(tetraploid) 2	13.197
	CNS0095609	Whole white alabastrum(tetraploid) 3	9.214
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	6.882
	CNS0095612	Silvery flower (tetraploid) 3	1.628
	CNS0095613	Golden flower (tetraploid) 1	0.018
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	14.111
	CRR073298	Stem 2	16.984
	CRR073299	Stem 3	15.442
	CRR073300	Leaf 1	32.782
	CRR073301	Leaf 2	32.053
	CRR073302	Leaf 3	36.667
	CRR073303	Juvenile bud 1	44.562
	CRR073304	Juvenile bud 2	23.274
	CRR073305	Juvenile bud 3	47.556
	CRR073306	Third green 1	0.141
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.348
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.070
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.039
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	14.109
	CRR073316	Gold flowering 2	20.753
	CRR073317	Gold flowering 3	5.778
	CRR073318	Tawny withering 1	2.649
	CRR073319	Tawny withering 2	0.353
	CRR073320	Tawny withering 3	1.879