Gene detail

Detail information of GWHGAAZE002170

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010656979.1	5.4482E-121	PREDICTED: dihydroorotase, mitochondrial isoform X3 [Vitis vinifera]
COG	YP_008547335.1	9E-85	dihydroorotase
Swissprot	tr\|O04904\|PYRC_ARATH	3E-110	Dihydroorotase, mitochondrial (Precursor)
trEMBL	tr\|F6H5E5\|F6H5E5_VITVI	3E-121	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB47294.1}
TAIR10	AT4G22930.1	2E-89	pyrimidin 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	71823830	71826791	+
GWHAAZE00000001	mRNA	71823830	71826791	+
GWHAAZE00000001	exon	71823830	71823912	+
GWHAAZE00000001	exon	71824129	71824310	+
GWHAAZE00000001	exon	71825772	71825908	+
GWHAAZE00000001	exon	71826564	71826791	+
GWHAAZE00000001	CDS	71823830	71823912	+
GWHAAZE00000001	CDS	71824129	71824310	+
GWHAAZE00000001	CDS	71825772	71825908	+
GWHAAZE00000001	CDS	71826564	71826791	+

Transcript Sequence
>GWHTAAZE002174 ATGGAGATCTCTATAACCCAACCTGATGATTGGCATCTTCATCTTCGTGATGGTGATTTGCTTGAAGCTGTTGTCTCTCACAGTGCACGTCATTTTGGAAGGGCAATAGTCATGCCAAACCTGAGACCTCCGATTACCACCACAGCTGCTGCAGTAGCATATCACCAATCCATCTTGAAAGTATTGCCAACCGATAGTGACTTCACACCTCTTATGACACTGTACTTGACAGATAAAACAAGTCCACATGAGATCAAACTAGCAAGAGAGAGTGGGATTGTATTTGCTGTAAAGCTGTACCCTGCTGGTGCTACAACAAATTCTCAAGACGGTGTTACTGACCTGTTTGGGAAGTGTGTACCTGTTCTAGAGGAGATGATTGTGCAAAATATGCCTCTTCTGGTCCATGGGGAGGTTACAAATCCCGATGTTGACGTATTTGATCGTGAGAAGGTATTTATTGATACCGTCCTAAGACCGTTAATACAGAAGTTCCCACTACTGAAAGTTGTGATGGAGCATATTACGACGATGGATGCTGTTAAGTTTGTTGAGTCTTGCAACGAAGGTATCTTTGGTTACTTGTATCTTTGCACTAACCTTTCTGTCTTTACTTTCCTCCCATTTTAA

Network for GWHGAAZE002170

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01979.21	Amidohydro_1	10	180	1.50E-11
PF04857.21	CAF1	25	138	2.30E-10

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01465	URA4, pyrC	Metabolic pathways	map01100
		Pyrimidine metabolism	map00240
		RNA degradation	map03018

Gene Ontology

GO term	Ontology	Name
GO:0003676	molecular_function	nucleic acid binding
GO:0016812	molecular_function	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides
GO:0016787	molecular_function	hydrolase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	15.561
	SRR3591706	second leaf	14.569
	SRR3591707	mature leaf	9.669
	SRR3591708	Shoot apex	15.764
	SRR3591709	Stem	17.342
	SRR3591710	White floral bud	20.842
	SRR3591711	White flower	23.996
	SRR3591712	Green floral bud	22.643
	SRR3591713	Yellow flower	31.149
SRP173429	SRR8316895	Juvenile bud stage	9.313
	SRR8316896	Juvenile bud stage	14.728
	SRR8316897	Juvenile bud stage	7.008
	SRR8316894	Third green stage	7.147
	SRR8316900	Third green stage	17.223
	SRR8316901	Third green stage	16.298
	SRR8316898	Complete white stage	5.615
	SRR8316899	Complete white stage	17.079
	SRR8316903	Complete white stage	11.781
	SRR8316902	Silver flowering stage	8.208
	SRR8316904	Silver flowering stage	12.178
	SRR8316905	Silver flowering stage	5.673
	SRR8316906	Gold flowering stage	20.738
	SRR8316907	Gold flowering stage	18.785
	SRR8316908	Gold flowering stage	18.417
SRP132670	SRR6706286	Control	13.417
	SRR6706287	Light intensity 50%	16.697
	SRR6706288	Light intensity 20%	16.533
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	9.076
	CNS0095593	Slightly white alabastrum(diploid) 2	7.065
	CNS0095594	Slightly white alabastrum(diploid) 3	6.886
	CNS0095595	Whole white alabastrum(diploid) 2	8.290
	CNS0095596	Whole white alabastrum(diploid) 3	7.318
	CNS0095597	Whole white alabastrum(diploid) 4	8.419
	CNS0095598	Silvery flower (diploied) 1	14.188
	CNS0095599	Silvery flower (diploied) 2	10.347
	CNS0095600	Silvery flower (diploied) 3	13.826
	CNS0095601	Golden flower (diploid) 1	6.943
	CNS0095602	Golden flower (diploid) 2	13.089
	CNS0095603	Golden flower (diploid) 3	12.652
	CNS0095604	Slightly white alabastrum(tetraploid) 1	7.475
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.959
	CNS0095606	Slightly white alabastrum(tetraploid) 3	11.522
	CNS0095607	Whole white alabastrum(tetraploid) 1	7.401
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.864
	CNS0095609	Whole white alabastrum(tetraploid) 3	11.788
	CNS0095610	Silvery flower (tetraploid) 1	13.773
	CNS0095611	Silvery flower (tetraploid) 2	17.203
	CNS0095612	Silvery flower (tetraploid) 3	11.857
	CNS0095613	Golden flower (tetraploid) 1	11.410
	CNS0095614	Golden flower (tetraploid) 2	12.560
	CNS0095615	Golden flower (tetraploid) 3	16.264
CRA001975	CRR073297	Stem 1	10.702
	CRR073298	Stem 2	10.395
	CRR073299	Stem 3	9.668
	CRR073300	Leaf 1	10.807
	CRR073301	Leaf 2	10.425
	CRR073302	Leaf 3	6.911
	CRR073303	Juvenile bud 1	7.053
	CRR073304	Juvenile bud 2	5.303
	CRR073305	Juvenile bud 3	10.109
	CRR073306	Third green 1	3.048
	CRR073307	Third green 2	2.657
	CRR073308	Third green 3	2.967
	CRR073309	Second white 1	8.228
	CRR073310	Second white 2	7.083
	CRR073311	Second white 3	7.665
	CRR073312	Silver flowering 1	9.348
	CRR073313	Silver flowering 2	3.901
	CRR073314	Silver flowering 3	6.416
	CRR073315	Gold flowering 1	2.341
	CRR073316	Gold flowering 2	7.198
	CRR073317	Gold flowering 3	4.941
	CRR073318	Tawny withering 1	6.387
	CRR073319	Tawny withering 2	6.733
	CRR073320	Tawny withering 3	6.976