Gene detail

Detail information of GWHGAAZE002191

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CBI27634.3	6.4269E-129	unnamed protein product [Vitis vinifera]
Swissprot	tr\|Q8VZE4\|PP299_ARATH	5E-103	Pentatricopeptide repeat-containing protein At4g01570
trEMBL	tr\|M1BBV2\|M1BBV2_SOLTU	3E-125	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400041714}
TAIR10	AT4G01570.1	1E-87	Tetratricopeptide repeat (TPR)-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	72498310	72498951	+
GWHAAZE00000001	mRNA	72498310	72498951	+
GWHAAZE00000001	exon	72498310	72498951	+
GWHAAZE00000001	CDS	72498310	72498951	+

Transcript Sequence
>GWHTAAZE002195 ATGGATTCTTTCGATATTGACATGGTCAATACCTACTTGTCTATATTTTTGGCCAAAGGAAAGGTAAGCTTAGCCTGTAAGTTATTTGAGATATTCAATGATATGGGTGTTGAAGCTGGGAGCTACACTTACAATTCCATGATGAGTTCTTTTGTAAAAAAAGGCTATTTCAACGAAGCTTGGGGTGTTTTTCAAGAAATGGGTGAGAAGGTCTGCCCAGCAGACATAGCAACCTATAATGTGATAATTCAAGGGTTGGGTAAGATGGGAAGGGCAGATCTAGCCAGTGCTATTCTCGATAATCTCATGAAGCAGGGTGGTTATCTTGACATAGTGATGTATAATACCCTCATTAACGCTCTTGGGAAAGCTGGTCGAATTGATGAAGCAAATAGGCTTTTTCAACAGATGAGGACGAGTGGGATAAATCCTGATGTTGTAACTTATAATACACTAATTGAGGTTCATAGCAAGGCGGGTAGATTAAAGGATGCTTACAAGTTCTTGAAGATGATGTTGGATGCTGGTTGTCCCCCTAACCATGTTACCGACACAACTTTGGACTTTTTGGAGAAAGAGATTGAGAAACTGAGATACCACAAGGCATCAATCAAAGGTCCTAACAAGGACAATTTTTCTTGA

Network for GWHGAAZE002191

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13041.7	PPR_2	41	87	1.30E-13
PF13041.7	PPR_2	110	149	1.10E-12

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C2H2

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding
GO:0003676	molecular_function	nucleic acid binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.315
	SRR3591706	second leaf	1.673
	SRR3591707	mature leaf	4.167
	SRR3591708	Shoot apex	2.649
	SRR3591709	Stem	3.903
	SRR3591710	White floral bud	3.090
	SRR3591711	White flower	1.530
	SRR3591712	Green floral bud	2.420
	SRR3591713	Yellow flower	3.511
SRP173429	SRR8316895	Juvenile bud stage	3.067
	SRR8316896	Juvenile bud stage	4.874
	SRR8316897	Juvenile bud stage	1.351
	SRR8316894	Third green stage	1.141
	SRR8316900	Third green stage	4.018
	SRR8316901	Third green stage	3.494
	SRR8316898	Complete white stage	0.900
	SRR8316899	Complete white stage	2.702
	SRR8316903	Complete white stage	2.262
	SRR8316902	Silver flowering stage	1.233
	SRR8316904	Silver flowering stage	2.500
	SRR8316905	Silver flowering stage	0.678
	SRR8316906	Gold flowering stage	3.091
	SRR8316907	Gold flowering stage	1.699
	SRR8316908	Gold flowering stage	2.290
SRP132670	SRR6706286	Control	0.216
	SRR6706287	Light intensity 50%	0.418
	SRR6706288	Light intensity 20%	0.911
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.728
	CNS0095593	Slightly white alabastrum(diploid) 2	2.358
	CNS0095594	Slightly white alabastrum(diploid) 3	4.391
	CNS0095595	Whole white alabastrum(diploid) 2	3.055
	CNS0095596	Whole white alabastrum(diploid) 3	4.488
	CNS0095597	Whole white alabastrum(diploid) 4	3.046
	CNS0095598	Silvery flower (diploied) 1	4.040
	CNS0095599	Silvery flower (diploied) 2	3.492
	CNS0095600	Silvery flower (diploied) 3	4.305
	CNS0095601	Golden flower (diploid) 1	2.459
	CNS0095602	Golden flower (diploid) 2	6.023
	CNS0095603	Golden flower (diploid) 3	5.265
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.806
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.460
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.308
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.856
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.750
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.873
	CNS0095610	Silvery flower (tetraploid) 1	5.077
	CNS0095611	Silvery flower (tetraploid) 2	4.919
	CNS0095612	Silvery flower (tetraploid) 3	2.679
	CNS0095613	Golden flower (tetraploid) 1	2.836
	CNS0095614	Golden flower (tetraploid) 2	3.793
	CNS0095615	Golden flower (tetraploid) 3	5.712
CRA001975	CRR073297	Stem 1	2.808
	CRR073298	Stem 2	1.173
	CRR073299	Stem 3	0.735
	CRR073300	Leaf 1	0.407
	CRR073301	Leaf 2	0.708
	CRR073302	Leaf 3	0.741
	CRR073303	Juvenile bud 1	0.258
	CRR073304	Juvenile bud 2	0.403
	CRR073305	Juvenile bud 3	0.828
	CRR073306	Third green 1	0.367
	CRR073307	Third green 2	0.207
	CRR073308	Third green 3	0.370
	CRR073309	Second white 1	0.310
	CRR073310	Second white 2	1.593
	CRR073311	Second white 3	1.317
	CRR073312	Silver flowering 1	0.835
	CRR073313	Silver flowering 2	0.166
	CRR073314	Silver flowering 3	0.364
	CRR073315	Gold flowering 1	2.237
	CRR073316	Gold flowering 2	0.572
	CRR073317	Gold flowering 3	0.918
	CRR073318	Tawny withering 1	0.650
	CRR073319	Tawny withering 2	1.823
	CRR073320	Tawny withering 3	0.657