Gene detail

Detail information of GWHGAAZE002425

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009761035.1	9.596E-56	PREDICTED: protein-tyrosine-phosphatase IBR5-like [Nicotiana sylvestris]
COG	YP_004671514.1	0.0000007	hypothetical protein SNE_A11460
Swissprot	tr\|Q84JU4\|IBR5_ARATH	1E-40	Protein-tyrosine-phosphatase IBR5
trEMBL	tr\|B9SSI3\|B9SSI3_RICCO	9E-55	Dual specificity protein phosphatase, putative {ECO:0000313\|EMBL:EEF33426.1}
TAIR10	AT2G04550.1	3E-34	indole-3-butyric acid response 5

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	78505370	78507135	-
GWHAAZE00000001	mRNA	78505370	78507135	-
GWHAAZE00000001	exon	78505370	78505653	-
GWHAAZE00000001	exon	78506484	78506650	-
GWHAAZE00000001	exon	78506955	78507012	-
GWHAAZE00000001	exon	78507096	78507135	-
GWHAAZE00000001	CDS	78507096	78507135	-
GWHAAZE00000001	CDS	78506955	78507012	-
GWHAAZE00000001	CDS	78506484	78506650	-
GWHAAZE00000001	CDS	78505370	78505653	-

Transcript Sequence
>GWHTAAZE002429 ATGGTTGGATCTTGTTGGTGGATCAATCGCAATAACTTGGAGCAATGTGAAAAGGACAGGGCTCGTGTTCTAGTGCACTGCATGACAGGCAAAAATAGGTCACCAGCGGTTGTGATAGCTTACTTGATGAGAAGCAAAGGATGGAGGCTTGGTCAGAGTTACCAGTGGGTGAAAGAGCGCAGACCCTCAGTTGACATAAATCAAGGTTTCTATGCTACCCTTGCTAATTTCTCCAATTTTGAAGTAACCTCTATATATGTACATCCCATCTACAAGCAATTACAGGACTATGAGCAGCAGGTCTTTGGGTCAACCGAGAACATCATCCCCGCCTCGTTGCCAAGCTTTGCCTCGTTAGGCGTGCAGCCTCCATCCTTCAGCTTTGGCTTCCCGAAACCCAACGACACAGTCCCTGTGCCCGCCCCCGCCTTCAACAGTAGCCAGACCACCTCCATTTTTGCGCGTCCGGCTTCAGATATACATGATTTCACTTTTGGGGCAAACCCGCAGAATCCGGCTGGTAATGATGTTGCCATGGATGGTTCTTGA

Network for GWHGAAZE002425

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00782.21	DSPc	12	79	2.10E-18

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K04459	DUSP, MKP	MAPK signaling pathway	map04010
K04459	DUSP, MKP	Axon regeneration	map04361

Gene Ontology

GO term	Ontology	Name
GO:0016311	biological_process	dephosphorylation
GO:0006470	biological_process	protein dephosphorylation
GO:0008138	molecular_function	protein tyrosine/serine/threonine phosphatase activity
GO:0016791	molecular_function	phosphatase activity
GO:0004725	molecular_function	protein tyrosine phosphatase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	37.415
	SRR3591706	second leaf	17.939
	SRR3591707	mature leaf	17.259
	SRR3591708	Shoot apex	38.227
	SRR3591709	Stem	35.946
	SRR3591710	White floral bud	45.317
	SRR3591711	White flower	48.339
	SRR3591712	Green floral bud	47.282
	SRR3591713	Yellow flower	44.499
SRP173429	SRR8316895	Juvenile bud stage	20.456
	SRR8316896	Juvenile bud stage	28.182
	SRR8316897	Juvenile bud stage	12.765
	SRR8316894	Third green stage	11.908
	SRR8316900	Third green stage	41.288
	SRR8316901	Third green stage	39.652
	SRR8316898	Complete white stage	25.265
	SRR8316899	Complete white stage	57.657
	SRR8316903	Complete white stage	32.710
	SRR8316902	Silver flowering stage	22.313
	SRR8316904	Silver flowering stage	24.088
	SRR8316905	Silver flowering stage	12.341
	SRR8316906	Gold flowering stage	40.504
	SRR8316907	Gold flowering stage	40.522
	SRR8316908	Gold flowering stage	46.796
SRP132670	SRR6706286	Control	42.130
	SRR6706287	Light intensity 50%	45.608
	SRR6706288	Light intensity 20%	48.146
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	30.563
	CNS0095593	Slightly white alabastrum(diploid) 2	34.477
	CNS0095594	Slightly white alabastrum(diploid) 3	28.764
	CNS0095595	Whole white alabastrum(diploid) 2	34.475
	CNS0095596	Whole white alabastrum(diploid) 3	40.801
	CNS0095597	Whole white alabastrum(diploid) 4	41.715
	CNS0095598	Silvery flower (diploied) 1	31.615
	CNS0095599	Silvery flower (diploied) 2	26.221
	CNS0095600	Silvery flower (diploied) 3	39.944
	CNS0095601	Golden flower (diploid) 1	23.133
	CNS0095602	Golden flower (diploid) 2	37.960
	CNS0095603	Golden flower (diploid) 3	34.720
	CNS0095604	Slightly white alabastrum(tetraploid) 1	40.249
	CNS0095605	Slightly white alabastrum(tetraploid) 2	40.308
	CNS0095606	Slightly white alabastrum(tetraploid) 3	38.974
	CNS0095607	Whole white alabastrum(tetraploid) 1	41.779
	CNS0095608	Whole white alabastrum(tetraploid) 2	42.283
	CNS0095609	Whole white alabastrum(tetraploid) 3	39.066
	CNS0095610	Silvery flower (tetraploid) 1	40.351
	CNS0095611	Silvery flower (tetraploid) 2	42.404
	CNS0095612	Silvery flower (tetraploid) 3	43.487
	CNS0095613	Golden flower (tetraploid) 1	33.572
	CNS0095614	Golden flower (tetraploid) 2	34.654
	CNS0095615	Golden flower (tetraploid) 3	40.938
CRA001975	CRR073297	Stem 1	23.599
	CRR073298	Stem 2	26.590
	CRR073299	Stem 3	25.156
	CRR073300	Leaf 1	30.519
	CRR073301	Leaf 2	30.331
	CRR073302	Leaf 3	29.787
	CRR073303	Juvenile bud 1	32.965
	CRR073304	Juvenile bud 2	38.074
	CRR073305	Juvenile bud 3	35.473
	CRR073306	Third green 1	27.637
	CRR073307	Third green 2	30.583
	CRR073308	Third green 3	34.148
	CRR073309	Second white 1	26.249
	CRR073310	Second white 2	19.317
	CRR073311	Second white 3	16.248
	CRR073312	Silver flowering 1	19.168
	CRR073313	Silver flowering 2	20.864
	CRR073314	Silver flowering 3	19.014
	CRR073315	Gold flowering 1	17.144
	CRR073316	Gold flowering 2	11.960
	CRR073317	Gold flowering 3	18.334
	CRR073318	Tawny withering 1	28.607
	CRR073319	Tawny withering 2	26.683
	CRR073320	Tawny withering 3	28.402