Gene detail

Detail information of GWHGAAZE002674

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010465471.1	3.00692E-49	PREDICTED: ethylene-responsive transcription factor 4-like [Camelina sativa]
Swissprot	tr\|O80340\|ERF78_ARATH	1E-43	Ethylene-responsive transcription factor 4
trEMBL	tr\|D7L402\|D7L402_ARALL	1E-43	ATERF-4/ATERF4/ERF4/RAP2.5 {ECO:0000313\|EMBL:EFH59179.1}
TAIR10	AT3G15210.1	4E-23	ethylene responsive element binding factor 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	83954589	83955308	+
GWHAAZE00000001	mRNA	83954589	83955308	+
GWHAAZE00000001	exon	83954589	83954876	+
GWHAAZE00000001	exon	83954916	83955308	+
GWHAAZE00000001	CDS	83954589	83954876	+
GWHAAZE00000001	CDS	83954916	83955308	+

Transcript Sequence
>GWHTAAZE002678 ATGGCTCCGAGAGCCAGGCCTATCACCTCCGTCAATGGCCCCACCACCCTTAACAACGTCAAGGAGACGCGCTACAGAGGCGTCAGGAAGAGGCCTTGGGGTCGTTACGCAGCCGAGATCAGAGATCCTGGCAAGAAGACGCGCGTCTGGCTCGGCACCTTCGATACGGCCGAGGAGGCCGCCCGTGCTTATGATGCTGCCGCGCGTGACTTTCGCGGCGTTAAGGCTAAGACCAACTTTCCCTCCGCTTCCGAACTCGTCGCCACGGCCACCGAGAAAATTCTCGCTAGCAGCACGGTGGAATCGTCGAGCTCCTTGCCGCGGCCGCCGCCACCTCCTATCTTGCCGGCGACGGCTGCTCCTCTGTTTCCGCCGTCGCTCGATCTGAGCCTAGCTAACTACGCTGGCGGACCGCACTTTCCGGCAGTCTTCTCTAAGGCGCCTCCCCTGTTCTATTACCACGCGCTGGCGCGTGCGGAAAATTTTAACAACCATTTCAACATGTTTAGATCGGAAAGGCCGGTACCGGTGGCCACTTTGCATCCTACTGCGGTTGCTGGCGGTGCACTGAGCGACTCCGATTCTTCTTCGATGGTCGAGAACAATTGTTCCGACCGTAATTCACGGAATTCCGGCCTGGAACTCGATCTGAACTTCCCCCCTCCGCCGGAAGTTGCCTGA

Network for GWHGAAZE002674

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	23	72	6.30E-15

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	83.191
	SRR3591706	second leaf	54.182
	SRR3591707	mature leaf	56.866
	SRR3591708	Shoot apex	128.727
	SRR3591709	Stem	182.896
	SRR3591710	White floral bud	48.926
	SRR3591711	White flower	133.287
	SRR3591712	Green floral bud	44.371
	SRR3591713	Yellow flower	67.893
SRP173429	SRR8316895	Juvenile bud stage	145.274
	SRR8316896	Juvenile bud stage	87.507
	SRR8316897	Juvenile bud stage	75.859
	SRR8316894	Third green stage	27.115
	SRR8316900	Third green stage	32.841
	SRR8316901	Third green stage	57.237
	SRR8316898	Complete white stage	3.167
	SRR8316899	Complete white stage	157.385
	SRR8316903	Complete white stage	4.648
	SRR8316902	Silver flowering stage	12.157
	SRR8316904	Silver flowering stage	6.981
	SRR8316905	Silver flowering stage	5.140
	SRR8316906	Gold flowering stage	27.316
	SRR8316907	Gold flowering stage	29.359
	SRR8316908	Gold flowering stage	30.481
SRP132670	SRR6706286	Control	13.162
	SRR6706287	Light intensity 50%	12.092
	SRR6706288	Light intensity 20%	11.126
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	155.884
	CNS0095593	Slightly white alabastrum(diploid) 2	168.517
	CNS0095594	Slightly white alabastrum(diploid) 3	174.016
	CNS0095595	Whole white alabastrum(diploid) 2	119.283
	CNS0095596	Whole white alabastrum(diploid) 3	31.814
	CNS0095597	Whole white alabastrum(diploid) 4	87.002
	CNS0095598	Silvery flower (diploied) 1	306.070
	CNS0095599	Silvery flower (diploied) 2	208.830
	CNS0095600	Silvery flower (diploied) 3	111.171
	CNS0095601	Golden flower (diploid) 1	296.824
	CNS0095602	Golden flower (diploid) 2	240.051
	CNS0095603	Golden flower (diploid) 3	231.025
	CNS0095604	Slightly white alabastrum(tetraploid) 1	21.593
	CNS0095605	Slightly white alabastrum(tetraploid) 2	22.873
	CNS0095606	Slightly white alabastrum(tetraploid) 3	22.446
	CNS0095607	Whole white alabastrum(tetraploid) 1	34.371
	CNS0095608	Whole white alabastrum(tetraploid) 2	26.350
	CNS0095609	Whole white alabastrum(tetraploid) 3	17.270
	CNS0095610	Silvery flower (tetraploid) 1	38.507
	CNS0095611	Silvery flower (tetraploid) 2	22.315
	CNS0095612	Silvery flower (tetraploid) 3	71.320
	CNS0095613	Golden flower (tetraploid) 1	34.723
	CNS0095614	Golden flower (tetraploid) 2	72.609
	CNS0095615	Golden flower (tetraploid) 3	10.943
CRA001975	CRR073297	Stem 1	190.622
	CRR073298	Stem 2	187.431
	CRR073299	Stem 3	346.943
	CRR073300	Leaf 1	153.264
	CRR073301	Leaf 2	236.043
	CRR073302	Leaf 3	124.887
	CRR073303	Juvenile bud 1	148.967
	CRR073304	Juvenile bud 2	96.417
	CRR073305	Juvenile bud 3	276.642
	CRR073306	Third green 1	121.996
	CRR073307	Third green 2	96.978
	CRR073308	Third green 3	97.313
	CRR073309	Second white 1	214.578
	CRR073310	Second white 2	228.957
	CRR073311	Second white 3	158.105
	CRR073312	Silver flowering 1	219.390
	CRR073313	Silver flowering 2	238.137
	CRR073314	Silver flowering 3	187.192
	CRR073315	Gold flowering 1	37.609
	CRR073316	Gold flowering 2	54.381
	CRR073317	Gold flowering 3	69.829
	CRR073318	Tawny withering 1	100.268
	CRR073319	Tawny withering 2	275.615
	CRR073320	Tawny withering 3	273.639