Gene detail

Detail information of GWHGAAZE002699

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU44935.1	9.34704E-57	hypothetical protein MIMGU_mgv1a025726mg [Erythranthe guttata]
Swissprot	tr\|Q39580\|DYL1_CHLRE	2E-19	Dynein 8 kDa light chain, flagellar outer arm
trEMBL	tr\|A0A022S139\|A0A022S139_ERYGU	3E-57	Uncharacterized protein {ECO:0000313\|EMBL:EYU44935.1}
TAIR10	AT5G20110.1	1E-21	Dynein light chain type 1 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	84469253	84470033	-
GWHAAZE00000001	mRNA	84469253	84470033	-
GWHAAZE00000001	exon	84469783	84470033	-
GWHAAZE00000001	exon	84469253	84469622	-
GWHAAZE00000001	five_prime_UTR	84470029	84470033	-
GWHAAZE00000001	CDS	84469783	84470028	-
GWHAAZE00000001	CDS	84469467	84469622	-
GWHAAZE00000001	three_prime_UTR	84469253	84469466	-

Transcript Sequence
>GWHTAAZE002703 TCTAGATGGAGAATAAAAAGAAATGGAAGGAGAAGCAGGTATTGAAATTTAAGTCTTTTTCTCATTCAACTCCGCCAGAGGAAGATCAGGTAAAGTTAGCTGCCATCGCCATCAGTCTGAACATACGGTTGAGATCAGCCGACATGCCCTCTACCATGCAAGAGCATGCTCTTCGCTGCACCAGATCACTTTTCGACGCTTCCCCTTCTACTCGTCCTAGCCCCACTCTCCTCGCTCGCTCCCTCAAAAAGGAGTTTGATGCGAAGTATGGGCCGGCGTGGCACTGTGTGGTGGGGAAGAGTTTCGGATCGTTTGTGACACACTCGCCGGGTGGGTTCATCTACTTCTCTCTAGACTCCCTCTCTTTTCTTCTTTTCAAAACAGAGGTCCACCTGCTCGATCCCTAGCTGATCGAACAACCCTCTTGTCAATGATAAAGTTGTAGTCATTACCCAAGTTGCTCGAAAATTTAGTTAGTTCCAATTCTGCATTTCCTCTAATTTATTTTCGGATGACTACTTTTAGAAGAGCTCGATGAAAGTGTATTTACTTTCTTACTACCTTAATTTGTTCTAGAAACTGGCCGGTTAGTTATATACGCAGCCTGCAGAGCATCTCCGT

Network for GWHGAAZE002699

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01221.19	Dynein_light	40	126	1.00E-31

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K10418	DYNLL	Vasopressin-regulated water reabsorption	map04962

Gene Ontology

GO term	Ontology	Name
GO:0007017	biological_process	microtubule-based process
GO:0030286	cellular_component	dynein complex

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.422
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	1.223
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.815
	SRR3591710	White floral bud	0.320
	SRR3591711	White flower	3.359
	SRR3591712	Green floral bud	0.224
	SRR3591713	Yellow flower	1.371
SRP173429	SRR8316895	Juvenile bud stage	0.307
	SRR8316896	Juvenile bud stage	1.859
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.210
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.114
	SRR8316898	Complete white stage	0.270
	SRR8316899	Complete white stage	0.391
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.263
	SRR8316904	Silver flowering stage	1.365
	SRR8316905	Silver flowering stage	0.313
	SRR8316906	Gold flowering stage	5.888
	SRR8316907	Gold flowering stage	1.755
	SRR8316908	Gold flowering stage	7.170
SRP132670	SRR6706286	Control	0.511
	SRR6706287	Light intensity 50%	0.426
	SRR6706288	Light intensity 20%	0.209
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.616
	CNS0095593	Slightly white alabastrum(diploid) 2	1.833
	CNS0095594	Slightly white alabastrum(diploid) 3	2.599
	CNS0095595	Whole white alabastrum(diploid) 2	0.644
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.226
	CNS0095598	Silvery flower (diploied) 1	1.211
	CNS0095599	Silvery flower (diploied) 2	1.807
	CNS0095600	Silvery flower (diploied) 3	1.542
	CNS0095601	Golden flower (diploid) 1	2.104
	CNS0095602	Golden flower (diploid) 2	1.888
	CNS0095603	Golden flower (diploid) 3	1.382
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.768
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.098
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.113
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.103
	CNS0095610	Silvery flower (tetraploid) 1	0.489
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.384
	CNS0095613	Golden flower (tetraploid) 1	2.325
	CNS0095614	Golden flower (tetraploid) 2	1.794
	CNS0095615	Golden flower (tetraploid) 3	0.518
CRA001975	CRR073297	Stem 1	0.839
	CRR073298	Stem 2	1.282
	CRR073299	Stem 3	0.917
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.504
	CRR073302	Leaf 3	0.085
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.079
	CRR073307	Third green 2	0.096
	CRR073308	Third green 3	0.424
	CRR073309	Second white 1	0.425
	CRR073310	Second white 2	0.723
	CRR073311	Second white 3	0.100
	CRR073312	Silver flowering 1	2.373
	CRR073313	Silver flowering 2	3.165
	CRR073314	Silver flowering 3	2.081
	CRR073315	Gold flowering 1	0.147
	CRR073316	Gold flowering 2	2.734
	CRR073317	Gold flowering 3	1.067
	CRR073318	Tawny withering 1	14.113
	CRR073319	Tawny withering 2	19.403
	CRR073320	Tawny withering 3	4.303