Gene detail

Detail information of GWHGAAZE002700

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007212109.1	8.00832E-62	hypothetical protein PRUPE_ppa011915mg [Prunus persica]
COG	YP_007080187.1	2E-46	thioredoxin
Swissprot	tr\|P48384\|TRXM_PEA	1E-52	Thioredoxin M-type, chloroplastic (Precursor)
trEMBL	tr\|M5WVD9\|M5WVD9_PRUPE	3E-62	Uncharacterized protein {ECO:0000313\|EMBL:EMJ13308.1}
TAIR10	AT3G15360.1	1E-41	thioredoxin M-type 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	84475355	84475669	+
GWHAAZE00000001	mRNA	84475355	84475669	+
GWHAAZE00000001	exon	84475355	84475669	+
GWHAAZE00000001	CDS	84475355	84475669	+

Transcript Sequence
>GWHTAAZE002704 GTGCCTCCCGTCACTACTGCAAGTTGGCAGTCACTTGTCCTCAATTCTGATACCCCTGTTCTGGTTGAATTTTGGGCTCCATGGTGTGGGCCATGCAAAATGATCCAACCTGTGATTGATGATCTGGCAAAGCAATACGCCGGAAAGCTCAAATGCTACAAGGTGAACACTGATGAGTCCCCTTCTATCGCCACTCAATATGGCATAAGAAGCATCCCAACGGTCATAATTTTCAAAAGTGGGGAAAAGAAAGATGCGGTTATTGGTGCGGTTCCCAAATCAACACTGACCACCTGTATAGAGAAGTTCTTGTAG

Network for GWHGAAZE002700

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00085.21	Thioredoxin	3	101	2.70E-32

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03671	trxA	NOD-like receptor signaling pathway	map04621

Gene Ontology

GO term	Ontology	Name
GO:0045454	biological_process	cell redox homeostasis
GO:0006662	biological_process	glycerol ether metabolic process
GO:0015035	molecular_function	protein disulfide oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	123.104
	SRR3591706	second leaf	191.344
	SRR3591707	mature leaf	256.147
	SRR3591708	Shoot apex	138.740
	SRR3591709	Stem	106.883
	SRR3591710	White floral bud	209.777
	SRR3591711	White flower	305.677
	SRR3591712	Green floral bud	149.530
	SRR3591713	Yellow flower	432.283
SRP173429	SRR8316895	Juvenile bud stage	66.189
	SRR8316896	Juvenile bud stage	98.182
	SRR8316897	Juvenile bud stage	50.941
	SRR8316894	Third green stage	40.553
	SRR8316900	Third green stage	129.115
	SRR8316901	Third green stage	119.817
	SRR8316898	Complete white stage	75.593
	SRR8316899	Complete white stage	161.408
	SRR8316903	Complete white stage	113.716
	SRR8316902	Silver flowering stage	74.707
	SRR8316904	Silver flowering stage	101.258
	SRR8316905	Silver flowering stage	59.592
	SRR8316906	Gold flowering stage	225.072
	SRR8316907	Gold flowering stage	179.452
	SRR8316908	Gold flowering stage	192.727
SRP132670	SRR6706286	Control	81.671
	SRR6706287	Light intensity 50%	87.091
	SRR6706288	Light intensity 20%	105.771
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	113.705
	CNS0095593	Slightly white alabastrum(diploid) 2	111.214
	CNS0095594	Slightly white alabastrum(diploid) 3	108.372
	CNS0095595	Whole white alabastrum(diploid) 2	86.519
	CNS0095596	Whole white alabastrum(diploid) 3	97.302
	CNS0095597	Whole white alabastrum(diploid) 4	98.246
	CNS0095598	Silvery flower (diploied) 1	173.684
	CNS0095599	Silvery flower (diploied) 2	170.607
	CNS0095600	Silvery flower (diploied) 3	272.444
	CNS0095601	Golden flower (diploid) 1	234.427
	CNS0095602	Golden flower (diploid) 2	288.775
	CNS0095603	Golden flower (diploid) 3	276.311
	CNS0095604	Slightly white alabastrum(tetraploid) 1	124.195
	CNS0095605	Slightly white alabastrum(tetraploid) 2	114.436
	CNS0095606	Slightly white alabastrum(tetraploid) 3	144.922
	CNS0095607	Whole white alabastrum(tetraploid) 1	84.210
	CNS0095608	Whole white alabastrum(tetraploid) 2	110.221
	CNS0095609	Whole white alabastrum(tetraploid) 3	156.576
	CNS0095610	Silvery flower (tetraploid) 1	340.580
	CNS0095611	Silvery flower (tetraploid) 2	457.615
	CNS0095612	Silvery flower (tetraploid) 3	488.347
	CNS0095613	Golden flower (tetraploid) 1	506.329
	CNS0095614	Golden flower (tetraploid) 2	378.073
	CNS0095615	Golden flower (tetraploid) 3	709.974
CRA001975	CRR073297	Stem 1	138.491
	CRR073298	Stem 2	140.267
	CRR073299	Stem 3	181.548
	CRR073300	Leaf 1	143.924
	CRR073301	Leaf 2	158.126
	CRR073302	Leaf 3	168.912
	CRR073303	Juvenile bud 1	168.069
	CRR073304	Juvenile bud 2	212.723
	CRR073305	Juvenile bud 3	168.652
	CRR073306	Third green 1	169.849
	CRR073307	Third green 2	164.133
	CRR073308	Third green 3	130.850
	CRR073309	Second white 1	415.388
	CRR073310	Second white 2	284.240
	CRR073311	Second white 3	239.720
	CRR073312	Silver flowering 1	299.986
	CRR073313	Silver flowering 2	362.331
	CRR073314	Silver flowering 3	244.300
	CRR073315	Gold flowering 1	262.120
	CRR073316	Gold flowering 2	268.739
	CRR073317	Gold flowering 3	303.698
	CRR073318	Tawny withering 1	149.557
	CRR073319	Tawny withering 2	114.761
	CRR073320	Tawny withering 3	133.777