Gene detail

Detail information of GWHGAAZE003077

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009769851.1	7.5099E-154	PREDICTED: chlorophyll a-b binding protein 6A, chloroplastic [Nicotiana sylvestris]
Swissprot	tr\|P12360\|CB11_SOLLC	2E-148	Chlorophyll a-b binding protein 6A, chloroplastic (Precursor)
trEMBL	tr\|W9RZD3\|W9RZD3_9ROSA	2E-152	Chlorophyll a-b binding protein 6A {ECO:0000313\|EMBL:EXB80094.1}
TAIR10	AT3G54890.1	1E-107	photosystem I light harvesting complex gene 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	91593069	91594622	+
GWHAAZE00000001	mRNA	91593069	91594622	+
GWHAAZE00000001	exon	91593069	91593268	+
GWHAAZE00000001	exon	91593498	91593600	+
GWHAAZE00000001	exon	91594023	91594311	+
GWHAAZE00000001	exon	91594471	91594622	+
GWHAAZE00000001	CDS	91593069	91593268	+
GWHAAZE00000001	CDS	91593498	91593600	+
GWHAAZE00000001	CDS	91594023	91594311	+
GWHAAZE00000001	CDS	91594471	91594622	+

Transcript Sequence
>GWHTAAZE003081 ATGGCCAAGGCATTAATGAGCTGCGGAATTCCGGCAGTTTGCCCATCAGTACTCTCTTCTTCTAAGTCAAAGTTTGCTAATTCGGTTTCGCTCTCTGCTGCTGTTGGTAGCAATGTTACTACTTCGTCCCGCATCACCATGACTGCTGACTGGATGCCTGGCGAACCCCGCCCACCCTACCTCGATGGCTCCGCACCCGGAGACTTTGGATTTGATCCGCTTGGTCTTGGGGCAGTACCAGAGAACCTGGAGAGATACAAAGAGTCTGAACTCATCCACTGCAGATGGGCTATGCTGGCCGTGCCTGGGATCTTAATACCAGAGGCATTAGGCTTGGGTAACTGGGTAAAAGCACAAGAGTGGGCAGCACAACCAGGAGGACAAGCCACCTATTTGGGCAACCCAGTCCCATGGGGCACCCTCCCAACTATTTTGGTCATTGAATTCCTCTCCATCGCCTTCGTAGAGCACCAGAGGAGCATGGAGAAAGACCCTGAGAAGAAGAAGTACCCTGGTGGTGCTTTCGACCCTTTAGGCTACTCCAAGGACCCGGCTAAGTTGGCAGAGTACAAGGTCAAAGAGGTCAAGAACGGCCGACTTGCATTGTTGGCGTTCGTGGGGTTCTGCGTTCAACAGTCGGCATATCCTGGGACAGGGCCATTGGAGAACTTGGCGACTCACTTGGCCGACCCGTGGCACAACAACATTGGGAATGTCATCATCCCTAAAGGGCTTTTGCCTTGA

Network for GWHGAAZE003077

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00504.22	Chloroa_b-bind	58	212	6.10E-47

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08907	LHCA1	Metabolic pathways	map01100
K08907	LHCA1	Photosynthesis - antenna proteins	map00196

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1143.563
	SRR3591706	second leaf	6363.364
	SRR3591707	mature leaf	4284.650
	SRR3591708	Shoot apex	2315.608
	SRR3591709	Stem	768.520
	SRR3591710	White floral bud	76.310
	SRR3591711	White flower	88.037
	SRR3591712	Green floral bud	77.217
	SRR3591713	Yellow flower	18.040
SRP173429	SRR8316895	Juvenile bud stage	305.867
	SRR8316896	Juvenile bud stage	224.708
	SRR8316897	Juvenile bud stage	154.676
	SRR8316894	Third green stage	70.531
	SRR8316900	Third green stage	88.860
	SRR8316901	Third green stage	83.371
	SRR8316898	Complete white stage	14.441
	SRR8316899	Complete white stage	56.913
	SRR8316903	Complete white stage	38.685
	SRR8316902	Silver flowering stage	6.507
	SRR8316904	Silver flowering stage	10.736
	SRR8316905	Silver flowering stage	3.430
	SRR8316906	Gold flowering stage	9.215
	SRR8316907	Gold flowering stage	11.751
	SRR8316908	Gold flowering stage	10.339
SRP132670	SRR6706286	Control	127.936
	SRR6706287	Light intensity 50%	82.406
	SRR6706288	Light intensity 20%	73.241
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	347.825
	CNS0095593	Slightly white alabastrum(diploid) 2	256.489
	CNS0095594	Slightly white alabastrum(diploid) 3	259.497
	CNS0095595	Whole white alabastrum(diploid) 2	158.724
	CNS0095596	Whole white alabastrum(diploid) 3	102.663
	CNS0095597	Whole white alabastrum(diploid) 4	89.158
	CNS0095598	Silvery flower (diploied) 1	472.081
	CNS0095599	Silvery flower (diploied) 2	387.553
	CNS0095600	Silvery flower (diploied) 3	81.999
	CNS0095601	Golden flower (diploid) 1	440.191
	CNS0095602	Golden flower (diploid) 2	256.930
	CNS0095603	Golden flower (diploid) 3	253.326
	CNS0095604	Slightly white alabastrum(tetraploid) 1	298.211
	CNS0095605	Slightly white alabastrum(tetraploid) 2	359.744
	CNS0095606	Slightly white alabastrum(tetraploid) 3	528.276
	CNS0095607	Whole white alabastrum(tetraploid) 1	166.636
	CNS0095608	Whole white alabastrum(tetraploid) 2	67.534
	CNS0095609	Whole white alabastrum(tetraploid) 3	123.091
	CNS0095610	Silvery flower (tetraploid) 1	79.850
	CNS0095611	Silvery flower (tetraploid) 2	120.331
	CNS0095612	Silvery flower (tetraploid) 3	55.748
	CNS0095613	Golden flower (tetraploid) 1	16.679
	CNS0095614	Golden flower (tetraploid) 2	116.718
	CNS0095615	Golden flower (tetraploid) 3	29.807
CRA001975	CRR073297	Stem 1	363.939
	CRR073298	Stem 2	313.488
	CRR073299	Stem 3	575.671
	CRR073300	Leaf 1	64.452
	CRR073301	Leaf 2	85.476
	CRR073302	Leaf 3	105.407
	CRR073303	Juvenile bud 1	51.237
	CRR073304	Juvenile bud 2	30.774
	CRR073305	Juvenile bud 3	63.750
	CRR073306	Third green 1	7.173
	CRR073307	Third green 2	10.885
	CRR073308	Third green 3	22.361
	CRR073309	Second white 1	13.624
	CRR073310	Second white 2	7.797
	CRR073311	Second white 3	5.069
	CRR073312	Silver flowering 1	10.294
	CRR073313	Silver flowering 2	15.438
	CRR073314	Silver flowering 3	17.606
	CRR073315	Gold flowering 1	4063.648
	CRR073316	Gold flowering 2	3336.453
	CRR073317	Gold flowering 3	4515.964
	CRR073318	Tawny withering 1	328.456
	CRR073319	Tawny withering 2	289.231
	CRR073320	Tawny withering 3	318.141