Gene detail

Detail information of GWHGAAZE003100

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004251154.1	0	PREDICTED: elongation factor 1-alpha-like [Solanum lycopersicum]
COG	YP_004780353.1	5E-133	translation elongation factor EF-1 subunit alpha
Swissprot	tr\|P17786\|EF1A_SOLLC	0	Elongation factor 1-alpha
trEMBL	tr\|K4DAC6\|K4DAC6_SOLLC	0	Elongation factor 1-alpha {ECO:0000256\|RuleBase:RU004060}
TAIR10	AT5G60390.3	1E-172	GTP binding Elongation factor Tu family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	92149979	92151467	-
GWHAAZE00000001	mRNA	92149979	92151467	-
GWHAAZE00000001	exon	92151048	92151467	-
GWHAAZE00000001	exon	92149979	92150467	-
GWHAAZE00000001	CDS	92151048	92151467	-
GWHAAZE00000001	CDS	92149979	92150467	-

Transcript Sequence
>GWHTAAZE003106 TCATGTCGACTCGGCAAGTCAACCACGACAGGTCATCTCATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTTGAGAAGGAGGCCGCTGAGATGAACAAGCGTTCATTCAAGTATGCCTGGGTGCTTGACAAGCTCAAGGCTGAGCGTGAGCGTGGTATCACCATCGACATTGCGCTATGGAAATTTGAGACCACCAAATACTACTGCACAGTCATTGATGCTCCTGGTCACCGAGACTTTATCAAGAACATGATCACCGGAACTTCTCAGGCAGATTGCGCTATCCTCATCATTGACTCCACCACTGGAGGTTTCGAAGCTGGTATTTCGAGGGATGGTCAAACCCGTGAGCACGCCTTGCTTGCCTTCACACTTGGTGTCAGGCAGATGATTTGTTGCTGCAACAAGATGGATGCTACAACCCCGAAGTATTCCAAGGCAAGGTATGATGAAATTGTCAAGGAGGTGTCGTCGTACCTGAAGAAGGTGGGATATAACCCTGACAAGATCCCATTTGTTCCCATATCAGGATTCGAAGGTGACAACATGATCGAGAGGTCTACAAACCTTGACTGGTACAAGGGCCCCACCCTTCTCGAGTCCCTTGACCAGCTCCAAGAGCCCAAGAGACCTTCAGACAAGCCCCTCCGTCTCCCTCTACAGGATGTGTACAAGATTGGAGGGATTGGAACTGTCCCAGTTGGGCGGGTTGAAACCGGTACCATAAAGCCCGGTATGGTCGTAACTTTTGGCCCAACTGGCCTAACCACCGGAGTCAAATCTGTTGAGATGCACCACGAGGCTCTCCAGGAGGCTCTACCTGGAGACAATGTGGGATTCAATGTGAAGAATGTTGCCGTTAAGGATCTCAAGCGTGGTTATGTTGCGTCTAATTGA

Network for GWHGAAZE003100

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00009.28	GTP_EFTU	5	208	1.90E-45
PF03144.26	GTP_EFTU_D2	234	299	3.20E-14

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03231	EEF1A	RNA transport	map03013

Gene Ontology

GO term	Ontology	Name
GO:0005525	molecular_function	GTP binding
GO:0003924	molecular_function	GTPase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	16.608
	SRR3591706	second leaf	5.905
	SRR3591707	mature leaf	7.100
	SRR3591708	Shoot apex	17.897
	SRR3591709	Stem	12.982
	SRR3591710	White floral bud	15.294
	SRR3591711	White flower	30.924
	SRR3591712	Green floral bud	19.697
	SRR3591713	Yellow flower	20.056
SRP173429	SRR8316895	Juvenile bud stage	14.744
	SRR8316896	Juvenile bud stage	20.191
	SRR8316897	Juvenile bud stage	9.323
	SRR8316894	Third green stage	6.256
	SRR8316900	Third green stage	22.976
	SRR8316901	Third green stage	19.721
	SRR8316898	Complete white stage	2.739
	SRR8316899	Complete white stage	24.013
	SRR8316903	Complete white stage	7.171
	SRR8316902	Silver flowering stage	6.663
	SRR8316904	Silver flowering stage	7.665
	SRR8316905	Silver flowering stage	3.830
	SRR8316906	Gold flowering stage	15.993
	SRR8316907	Gold flowering stage	13.551
	SRR8316908	Gold flowering stage	13.988
SRP132670	SRR6706286	Control	16.512
	SRR6706287	Light intensity 50%	14.876
	SRR6706288	Light intensity 20%	16.632
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	10.467
	CNS0095593	Slightly white alabastrum(diploid) 2	13.481
	CNS0095594	Slightly white alabastrum(diploid) 3	12.009
	CNS0095595	Whole white alabastrum(diploid) 2	10.532
	CNS0095596	Whole white alabastrum(diploid) 3	9.443
	CNS0095597	Whole white alabastrum(diploid) 4	7.259
	CNS0095598	Silvery flower (diploied) 1	16.252
	CNS0095599	Silvery flower (diploied) 2	14.874
	CNS0095600	Silvery flower (diploied) 3	16.692
	CNS0095601	Golden flower (diploid) 1	18.600
	CNS0095602	Golden flower (diploid) 2	27.418
	CNS0095603	Golden flower (diploid) 3	25.166
	CNS0095604	Slightly white alabastrum(tetraploid) 1	15.531
	CNS0095605	Slightly white alabastrum(tetraploid) 2	14.203
	CNS0095606	Slightly white alabastrum(tetraploid) 3	43.451
	CNS0095607	Whole white alabastrum(tetraploid) 1	7.333
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.592
	CNS0095609	Whole white alabastrum(tetraploid) 3	25.817
	CNS0095610	Silvery flower (tetraploid) 1	24.651
	CNS0095611	Silvery flower (tetraploid) 2	26.488
	CNS0095612	Silvery flower (tetraploid) 3	18.399
	CNS0095613	Golden flower (tetraploid) 1	9.595
	CNS0095614	Golden flower (tetraploid) 2	19.472
	CNS0095615	Golden flower (tetraploid) 3	9.494
CRA001975	CRR073297	Stem 1	34.894
	CRR073298	Stem 2	34.072
	CRR073299	Stem 3	42.817
	CRR073300	Leaf 1	42.374
	CRR073301	Leaf 2	40.253
	CRR073302	Leaf 3	46.315
	CRR073303	Juvenile bud 1	41.030
	CRR073304	Juvenile bud 2	26.671
	CRR073305	Juvenile bud 3	62.802
	CRR073306	Third green 1	7.726
	CRR073307	Third green 2	5.696
	CRR073308	Third green 3	8.952
	CRR073309	Second white 1	23.946
	CRR073310	Second white 2	16.612
	CRR073311	Second white 3	18.870
	CRR073312	Silver flowering 1	16.045
	CRR073313	Silver flowering 2	24.512
	CRR073314	Silver flowering 3	13.383
	CRR073315	Gold flowering 1	23.603
	CRR073316	Gold flowering 2	24.518
	CRR073317	Gold flowering 3	29.729
	CRR073318	Tawny withering 1	38.002
	CRR073319	Tawny withering 2	26.708
	CRR073320	Tawny withering 3	33.177