Gene detail

Detail information of GWHGAAZE003130

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009769893.1	8.6049E-120	PREDICTED: 50S ribosomal protein L10, chloroplastic [Nicotiana sylvestris]
COG	YP_007099551.1	5E-24	ribosomal protein L10
Swissprot	tr\|O80362\|RK10_TOBAC	2E-120	50S ribosomal protein L10, chloroplastic (Precursor)
trEMBL	tr\|A0A068U719\|A0A068U719_COFCA	3E-120	Coffea canephora DH200=94 genomic scaffold, scaffold_12 {ECO:0000313\|EMBL:CDP04330.1}
TAIR10	AT5G13510.1	9E-78	Ribosomal protein L10 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	92641652	92642344	+
GWHAAZE00000001	mRNA	92641652	92642344	+
GWHAAZE00000001	exon	92641652	92642344	+
GWHAAZE00000001	CDS	92641652	92642344	+

Transcript Sequence
>GWHTAAZE003136 ATGGAAGCTACACTTTTCACATTCCCCTCTTCAAAACCCCCACCCTCCTCTCAAACCCTATCCCTAAAATCCCATTTCAAAAACCCCCTCCTTATCACTACCAACACCAAAAAACCCCTCTTTTCCCACAAACCCATCTCAATCCGAGCCGCCATTAACCGCACAAAGAAAGAAGAAACAGTCGAAACAGTCAAGCAACAACTCCAAGACTGCCACCTCCTCGCCGGCATCAAATACAAAGGCCTCACAGTACAACAATTCCGGGAACTAAGAACTTCACTTCCGGAATCATCAAAACTCATTGTCGCCAAAAATACTTTAGTTTTTAAGGCAATTGAGGGGACCCAATGGGAGGCATTGAAGCCCTGCATGACGGGTATGAATGCTTGGTTGTTTGTTCACAGTGAGGAGATCCCGGCGGCCATTAAACCCTACCGGAATTTCCAGAGGGAGAAGAAATTGGAAGACAATGATTTTAGCGGGGCTGTTTTCGAGGGGAAGTATTACCCGCCCGAGGATTTTAAGACTTTGGAGTCTATGCCGACGAGGGCCGAGGTTTATGCCAAGCTCTTGGGGTCTTTTAAGGGACCCGCATCCGCCGTGGTGGGGACATTGCAGGCTCCGGCGAGGAATTTGGTGATGGTGTTGAGTGCTTATGTCAAGAAGTTGGAAGAGACTGGTGGGCAGCAATAG

Network for GWHGAAZE003130

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00466.21	Ribosomal_L10	53	145	3.30E-20

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02864	RP-L10, MRPL10, rplJ	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0042254	biological_process	ribosome biogenesis

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	79.200
	SRR3591706	second leaf	160.854
	SRR3591707	mature leaf	85.846
	SRR3591708	Shoot apex	168.409
	SRR3591709	Stem	22.867
	SRR3591710	White floral bud	32.027
	SRR3591711	White flower	28.500
	SRR3591712	Green floral bud	64.619
	SRR3591713	Yellow flower	18.901
SRP173429	SRR8316895	Juvenile bud stage	40.664
	SRR8316896	Juvenile bud stage	42.866
	SRR8316897	Juvenile bud stage	38.893
	SRR8316894	Third green stage	20.709
	SRR8316900	Third green stage	78.629
	SRR8316901	Third green stage	59.649
	SRR8316898	Complete white stage	16.587
	SRR8316899	Complete white stage	51.377
	SRR8316903	Complete white stage	17.437
	SRR8316902	Silver flowering stage	14.141
	SRR8316904	Silver flowering stage	15.648
	SRR8316905	Silver flowering stage	8.096
	SRR8316906	Gold flowering stage	15.748
	SRR8316907	Gold flowering stage	20.225
	SRR8316908	Gold flowering stage	20.369
SRP132670	SRR6706286	Control	77.734
	SRR6706287	Light intensity 50%	75.318
	SRR6706288	Light intensity 20%	82.522
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	51.227
	CNS0095593	Slightly white alabastrum(diploid) 2	45.181
	CNS0095594	Slightly white alabastrum(diploid) 3	36.180
	CNS0095595	Whole white alabastrum(diploid) 2	49.288
	CNS0095596	Whole white alabastrum(diploid) 3	49.520
	CNS0095597	Whole white alabastrum(diploid) 4	44.915
	CNS0095598	Silvery flower (diploied) 1	46.485
	CNS0095599	Silvery flower (diploied) 2	44.282
	CNS0095600	Silvery flower (diploied) 3	31.215
	CNS0095601	Golden flower (diploid) 1	37.809
	CNS0095602	Golden flower (diploid) 2	30.654
	CNS0095603	Golden flower (diploid) 3	29.388
	CNS0095604	Slightly white alabastrum(tetraploid) 1	35.635
	CNS0095605	Slightly white alabastrum(tetraploid) 2	33.479
	CNS0095606	Slightly white alabastrum(tetraploid) 3	49.572
	CNS0095607	Whole white alabastrum(tetraploid) 1	23.621
	CNS0095608	Whole white alabastrum(tetraploid) 2	24.819
	CNS0095609	Whole white alabastrum(tetraploid) 3	51.376
	CNS0095610	Silvery flower (tetraploid) 1	19.638
	CNS0095611	Silvery flower (tetraploid) 2	34.545
	CNS0095612	Silvery flower (tetraploid) 3	28.546
	CNS0095613	Golden flower (tetraploid) 1	13.966
	CNS0095614	Golden flower (tetraploid) 2	16.955
	CNS0095615	Golden flower (tetraploid) 3	18.726
CRA001975	CRR073297	Stem 1	75.412
	CRR073298	Stem 2	75.964
	CRR073299	Stem 3	103.562
	CRR073300	Leaf 1	57.252
	CRR073301	Leaf 2	68.853
	CRR073302	Leaf 3	84.588
	CRR073303	Juvenile bud 1	77.379
	CRR073304	Juvenile bud 2	88.244
	CRR073305	Juvenile bud 3	55.635
	CRR073306	Third green 1	42.936
	CRR073307	Third green 2	26.079
	CRR073308	Third green 3	32.405
	CRR073309	Second white 1	34.194
	CRR073310	Second white 2	17.315
	CRR073311	Second white 3	12.820
	CRR073312	Silver flowering 1	13.081
	CRR073313	Silver flowering 2	16.375
	CRR073314	Silver flowering 3	8.414
	CRR073315	Gold flowering 1	192.758
	CRR073316	Gold flowering 2	193.481
	CRR073317	Gold flowering 3	207.317
	CRR073318	Tawny withering 1	30.784
	CRR073319	Tawny withering 2	37.251
	CRR073320	Tawny withering 3	32.897