Gene detail

Detail information of GWHGAAZE003232

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009629737.1	1.7992E-143	PREDICTED: ras-related protein Rab2BV-like [Nicotiana tomentosiformis]
COG	YP_008431664.1	9E-26	hypothetical protein N186_01315
Swissprot	tr\|Q39434\|RB2BV_BETVU	3E-137	Ras-related protein Rab2BV
trEMBL	tr\|A0A068TVV2\|A0A068TVV2_COFCA	8E-144	Coffea canephora DH200=94 genomic scaffold, scaffold_4 {ECO:0000313\|EMBL:CDP00152.1}
TAIR10	AT1G07410.1	2E-104	RAB GTPase homolog A2B

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	94419985	94421064	-
GWHAAZE00000001	mRNA	94419985	94421064	-
GWHAAZE00000001	exon	94419985	94420464	-
GWHAAZE00000001	exon	94420900	94421064	-
GWHAAZE00000001	CDS	94420900	94421064	-
GWHAAZE00000001	CDS	94419985	94420464	-

Transcript Sequence
>GWHTAAZE003238 ATGGCATATAAGGTGGATCACGAATACGATTACTTATTTAAGATCGTGTTGATTGGAGATTCAGGTGTCGGTAAATCTAACATTCTTTCGAGGTTTACAAGGAATGAGTTTTGTTTGGAGTCCAAATCCACTATTGGTGTTGAATTTGCTACTAGGACTCTTCAGGTAGAGGGGAAGACAGTGAAAGCACAGATATGGGACACGGCCGGTCAAGAGAGGTACCGAGCCATCACAAGCGCTTATTACAGAGGTGCAGTCGGCGCCCTCTTGGTTTATGACATAACCAAGAGACAAACTTTCGAGAATGTACAAAGGTGGCTGCGCGAACTGAGGGACCACGCAGATTCCAACATAGTGATAATGTTGGCGGGCAACAAGTCCGACCTCAACCACTTGCGTGCAGTCCAAGAACAAGACGCCCAGCTCCTGGCCGAGAAGGAAAACCTCTCATTCCTTGAGACCTCTGCTTTAGAAGCACTTAACGTCGAAAAGGCTTTCCAAACGATTTTGCTTGACATTTATCAGATCATTAGCAGGAAGGCTTTGGCAGCTCAGGAGGCGGCTAATGTCCCTGGCCAAGGCACGACAATTAATGTTGGAGATTATTCTGGTAATTTCACCAGAAGAACTTGTTGTAGTAATTGA

Network for GWHGAAZE003232

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00071.23	Ras	14	174	3.70E-61

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07904	RAB11A	Endocytosis	map04144
		Pancreatic secretion	map04972
		Vasopressin-regulated water reabsorption	map04962
		Endocrine and other factor-regulated calcium reabsorption	map04961

Gene Ontology

GO term	Ontology	Name
GO:0005525	molecular_function	GTP binding
GO:0003924	molecular_function	GTPase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.817
	SRR3591706	second leaf	0.081
	SRR3591707	mature leaf	0.258
	SRR3591708	Shoot apex	0.091
	SRR3591709	Stem	0.429
	SRR3591710	White floral bud	9.551
	SRR3591711	White flower	0.807
	SRR3591712	Green floral bud	23.124
	SRR3591713	Yellow flower	0.193
SRP173429	SRR8316895	Juvenile bud stage	5.176
	SRR8316896	Juvenile bud stage	16.270
	SRR8316897	Juvenile bud stage	8.204
	SRR8316894	Third green stage	5.785
	SRR8316900	Third green stage	27.072
	SRR8316901	Third green stage	30.265
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.340
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.105
	SRR8316904	Silver flowering stage	0.172
	SRR8316905	Silver flowering stage	0.182
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.036
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	11.923
	SRR6706287	Light intensity 50%	10.918
	SRR6706288	Light intensity 20%	9.496
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	19.736
	CNS0095593	Slightly white alabastrum(diploid) 2	12.916
	CNS0095594	Slightly white alabastrum(diploid) 3	23.326
	CNS0095595	Whole white alabastrum(diploid) 2	32.362
	CNS0095596	Whole white alabastrum(diploid) 3	38.676
	CNS0095597	Whole white alabastrum(diploid) 4	45.701
	CNS0095598	Silvery flower (diploied) 1	1.239
	CNS0095599	Silvery flower (diploied) 2	1.785
	CNS0095600	Silvery flower (diploied) 3	0.737
	CNS0095601	Golden flower (diploid) 1	0.535
	CNS0095602	Golden flower (diploid) 2	0.748
	CNS0095603	Golden flower (diploid) 3	0.758
	CNS0095604	Slightly white alabastrum(tetraploid) 1	37.324
	CNS0095605	Slightly white alabastrum(tetraploid) 2	38.496
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	64.900
	CNS0095608	Whole white alabastrum(tetraploid) 2	68.809
	CNS0095609	Whole white alabastrum(tetraploid) 3	38.505
	CNS0095610	Silvery flower (tetraploid) 1	0.018
	CNS0095611	Silvery flower (tetraploid) 2	1.214
	CNS0095612	Silvery flower (tetraploid) 3	3.537
	CNS0095613	Golden flower (tetraploid) 1	0.548
	CNS0095614	Golden flower (tetraploid) 2	0.234
	CNS0095615	Golden flower (tetraploid) 3	1.504
CRA001975	CRR073297	Stem 1	4.655
	CRR073298	Stem 2	6.793
	CRR073299	Stem 3	5.914
	CRR073300	Leaf 1	12.925
	CRR073301	Leaf 2	13.616
	CRR073302	Leaf 3	8.800
	CRR073303	Juvenile bud 1	7.062
	CRR073304	Juvenile bud 2	10.702
	CRR073305	Juvenile bud 3	1.108
	CRR073306	Third green 1	2.498
	CRR073307	Third green 2	3.947
	CRR073308	Third green 3	2.807
	CRR073309	Second white 1	0.264
	CRR073310	Second white 2	0.500
	CRR073311	Second white 3	0.226
	CRR073312	Silver flowering 1	0.840
	CRR073313	Silver flowering 2	2.610
	CRR073314	Silver flowering 3	1.291
	CRR073315	Gold flowering 1	4.494
	CRR073316	Gold flowering 2	0.730
	CRR073317	Gold flowering 3	3.096
	CRR073318	Tawny withering 1	1.827
	CRR073319	Tawny withering 2	2.513
	CRR073320	Tawny withering 3	2.663