Gene detail

Detail information of GWHGAAZE003274

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006435676.1	8.3526E-43	hypothetical protein CICLE_v10032786mg [Citrus clementina]
Swissprot	tr\|P58684\|SPCS2_ARATH	7E-40	Probable signal peptidase complex subunit 2
trEMBL	tr\|V4TGS5\|V4TGS5_9ROSI	3E-43	Uncharacterized protein {ECO:0000313\|EMBL:ESR48916.1}
TAIR10	AT2G39960.1	3E-20	Microsomal signal peptidase 25 kDa subunit (SPC25)

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	95079980	95080376	-
GWHAAZE00000001	mRNA	95079980	95080376	-
GWHAAZE00000001	exon	95079980	95080165	-
GWHAAZE00000001	exon	95080266	95080376	-
GWHAAZE00000001	CDS	95080266	95080376	-
GWHAAZE00000001	CDS	95079980	95080165	-

Transcript Sequence
>GWHTAAZE003280 ATGACTGAAAAAAAGGGGGACATGGCCACAAACAACAACAAAAACCCTAAGAAGGCTAATCTCTTGGATCATCACTCCATCAAGCACTTACTCGATGAATCTGTATCTGAGATCGTGAGGAGCCGTGGTTACATTGAAAATGTGAGGATGAGTAACATTAGATTGCTGATTGGAACCATCATCATCGTCATTGCTCTCTTTGCTCAATTTTACAACAAGAAGTTCCCCGATAACAAGATGTTTCTGATCGGCTGCATAATATTATATCCTTTTTCCTCTGACCTATTTTCCACTTGA

Network for GWHGAAZE003274

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF06703.12	SPC25	27	91	4.00E-14

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12947	SPCS2, SPC2	Protein export	map03060

Gene Ontology

GO term	Ontology	Name
GO:0006465	biological_process	signal peptide processing
GO:0005787	cellular_component	signal peptidase complex
GO:0016021	cellular_component	integral component of membrane
GO:0008233	molecular_function	peptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	159.835
	SRR3591706	second leaf	50.920
	SRR3591707	mature leaf	51.096
	SRR3591708	Shoot apex	87.226
	SRR3591709	Stem	123.033
	SRR3591710	White floral bud	120.986
	SRR3591711	White flower	152.132
	SRR3591712	Green floral bud	124.302
	SRR3591713	Yellow flower	128.820
SRP173429	SRR8316895	Juvenile bud stage	64.363
	SRR8316896	Juvenile bud stage	97.150
	SRR8316897	Juvenile bud stage	46.344
	SRR8316894	Third green stage	36.525
	SRR8316900	Third green stage	141.297
	SRR8316901	Third green stage	116.917
	SRR8316898	Complete white stage	78.242
	SRR8316899	Complete white stage	180.797
	SRR8316903	Complete white stage	93.422
	SRR8316902	Silver flowering stage	79.556
	SRR8316904	Silver flowering stage	114.563
	SRR8316905	Silver flowering stage	44.918
	SRR8316906	Gold flowering stage	157.079
	SRR8316907	Gold flowering stage	167.356
	SRR8316908	Gold flowering stage	162.046
SRP132670	SRR6706286	Control	18.533
	SRR6706287	Light intensity 50%	21.488
	SRR6706288	Light intensity 20%	24.389
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	97.677
	CNS0095593	Slightly white alabastrum(diploid) 2	108.138
	CNS0095594	Slightly white alabastrum(diploid) 3	82.481
	CNS0095595	Whole white alabastrum(diploid) 2	87.662
	CNS0095596	Whole white alabastrum(diploid) 3	95.325
	CNS0095597	Whole white alabastrum(diploid) 4	90.683
	CNS0095598	Silvery flower (diploied) 1	87.269
	CNS0095599	Silvery flower (diploied) 2	79.931
	CNS0095600	Silvery flower (diploied) 3	154.009
	CNS0095601	Golden flower (diploid) 1	84.067
	CNS0095602	Golden flower (diploid) 2	124.752
	CNS0095603	Golden flower (diploid) 3	117.411
	CNS0095604	Slightly white alabastrum(tetraploid) 1	94.265
	CNS0095605	Slightly white alabastrum(tetraploid) 2	82.460
	CNS0095606	Slightly white alabastrum(tetraploid) 3	121.574
	CNS0095607	Whole white alabastrum(tetraploid) 1	87.662
	CNS0095608	Whole white alabastrum(tetraploid) 2	68.863
	CNS0095609	Whole white alabastrum(tetraploid) 3	117.868
	CNS0095610	Silvery flower (tetraploid) 1	174.340
	CNS0095611	Silvery flower (tetraploid) 2	142.535
	CNS0095612	Silvery flower (tetraploid) 3	124.785
	CNS0095613	Golden flower (tetraploid) 1	91.191
	CNS0095614	Golden flower (tetraploid) 2	124.666
	CNS0095615	Golden flower (tetraploid) 3	98.388
CRA001975	CRR073297	Stem 1	28.814
	CRR073298	Stem 2	32.931
	CRR073299	Stem 3	29.750
	CRR073300	Leaf 1	45.584
	CRR073301	Leaf 2	38.018
	CRR073302	Leaf 3	32.261
	CRR073303	Juvenile bud 1	40.947
	CRR073304	Juvenile bud 2	45.064
	CRR073305	Juvenile bud 3	34.276
	CRR073306	Third green 1	24.888
	CRR073307	Third green 2	35.465
	CRR073308	Third green 3	26.341
	CRR073309	Second white 1	54.505
	CRR073310	Second white 2	40.096
	CRR073311	Second white 3	35.157
	CRR073312	Silver flowering 1	28.740
	CRR073313	Silver flowering 2	22.258
	CRR073314	Silver flowering 3	22.363
	CRR073315	Gold flowering 1	32.519
	CRR073316	Gold flowering 2	35.010
	CRR073317	Gold flowering 3	24.488
	CRR073318	Tawny withering 1	56.455
	CRR073319	Tawny withering 2	64.914
	CRR073320	Tawny withering 3	61.589