Gene detail

Detail information of GWHGAAZE003312

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP44734.1	6.21199E-66	hypothetical protein JCGZ_01234 [Jatropha curcas]
Swissprot	tr\|Q9FDW1\|MYB44_ARATH	2E-47	Transcription factor MYB44
trEMBL	tr\|A0A067LKB3\|A0A067LKB3_JATCU	2E-66	Uncharacterized protein {ECO:0000313\|EMBL:KDP44734.1}
TAIR10	AT3G50060.1	3E-39	myb domain protein 77

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	95848366	95848749	+
GWHAAZE00000001	mRNA	95848366	95848749	+
GWHAAZE00000001	exon	95848366	95848749	+
GWHAAZE00000001	CDS	95848366	95848749	+

Transcript Sequence
>GWHTAAZE003318 ATGGGAATCACCGGTGGTGATAACATAAAGGGTTCGTGGACCCCAAAGGAAGATGCCACTTTAATCAGGCTGGTGGAGGAACAGGGCCCACGCAATTGGTCCCTCATAAGCACCGGCATACCTGGACGCTCCGGCAAGTCTTGTCGCTTGCGGTGGTGCAACCAGCTTTGCCCCACGGTGCAGCACCTCCCCTTTTCTCCAGCAGAAGATGCAATCATACTCAAAAACCACGCTATCCACGGCAATAGATGGGCCACAATCGCCCGCCTGTTGCCCGGAAGAACCGACAATGCCATCAAAAACCACTGGAACTCCACCCTGCGAAAGCGCCTGAATGCTGCCATGTCAGCATCGTCCAGATCGAACTCTGCTGTGAAGCGGCCT

Network for GWHGAAZE003312

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00249.32	Myb_DNA-binding	10	55	1.80E-16
PF00249.32	Myb_DNA-binding	64	106	2.00E-13

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	MYB

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.415
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.686
	SRR3591710	White floral bud	0.212
	SRR3591711	White flower	0.193
	SRR3591712	Green floral bud	4.325
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	5.366
	SRR8316896	Juvenile bud stage	9.174
	SRR8316897	Juvenile bud stage	4.301
	SRR8316894	Third green stage	1.497
	SRR8316900	Third green stage	2.240
	SRR8316901	Third green stage	1.803
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	1.093
	SRR8316903	Complete white stage	0.096
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.001
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	3.335
	SRR6706287	Light intensity 50%	3.838
	SRR6706288	Light intensity 20%	3.527
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.215
	CNS0095593	Slightly white alabastrum(diploid) 2	2.796
	CNS0095594	Slightly white alabastrum(diploid) 3	6.631
	CNS0095595	Whole white alabastrum(diploid) 2	1.721
	CNS0095596	Whole white alabastrum(diploid) 3	4.242
	CNS0095597	Whole white alabastrum(diploid) 4	1.816
	CNS0095598	Silvery flower (diploied) 1	0.140
	CNS0095599	Silvery flower (diploied) 2	0.260
	CNS0095600	Silvery flower (diploied) 3	0.707
	CNS0095601	Golden flower (diploid) 1	0.618
	CNS0095602	Golden flower (diploid) 2	0.297
	CNS0095603	Golden flower (diploid) 3	0.201
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.437
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.779
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.704
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.765
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.722
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.344
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.187
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.458
	CNS0095615	Golden flower (tetraploid) 3	0.145
CRA001975	CRR073297	Stem 1	13.761
	CRR073298	Stem 2	12.860
	CRR073299	Stem 3	41.794
	CRR073300	Leaf 1	1.573
	CRR073301	Leaf 2	2.001
	CRR073302	Leaf 3	0.705
	CRR073303	Juvenile bud 1	1.004
	CRR073304	Juvenile bud 2	0.808
	CRR073305	Juvenile bud 3	0.159
	CRR073306	Third green 1	0.467
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.598
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.165
	CRR073315	Gold flowering 1	1.037
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.353
	CRR073318	Tawny withering 1	0.268
	CRR073319	Tawny withering 2	0.103
	CRR073320	Tawny withering 3	0.831