Gene detail

Detail information of GWHGAAZE003371

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002280746.1	1.69348E-80	PREDICTED: two-component response regulator ARR17 isoform X1 [Vitis vinifera]
COG	YP_007366263.1	1E-16	response regulator receiver protein
Swissprot	tr\|Q9FPR6\|ARR17_ARATH	4E-65	Two-component response regulator ARR17
trEMBL	tr\|F6HC71\|F6HC71_VITVI	6E-81	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB49783.1}
TAIR10	AT3G56380.1	6E-52	response regulator 17

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	96754721	96756011	+
GWHAAZE00000001	mRNA	96754721	96756011	+
GWHAAZE00000001	exon	96754721	96754868	+
GWHAAZE00000001	exon	96755356	96755435	+
GWHAAZE00000001	exon	96755566	96755643	+
GWHAAZE00000001	exon	96755753	96755823	+
GWHAAZE00000001	exon	96755912	96756011	+
GWHAAZE00000001	CDS	96754721	96754868	+
GWHAAZE00000001	CDS	96755356	96755435	+
GWHAAZE00000001	CDS	96755566	96755643	+
GWHAAZE00000001	CDS	96755753	96755823	+
GWHAAZE00000001	CDS	96755912	96756011	+

Transcript Sequence
>GWHTAAZE003377 ATGGATGCTGCTAGTAATGTCTCTTGTTCTGCTTTTCTGTCAAAGGGAATTATGGATTTTGGGGAAGAACCCCACGTATTAGCTGTTGATGATAATCTCATTGATCGTAAACTTGTCGAAAAGTTGCTCAAAAACTCCTCTTGCAAAGTGACTACTGCAGAAAATGGGTTGAGGGCATTAGAGTACTTGGGTTTGAGAGATAATCAAGAGAACACTTTGAATGGCAGTTGTTCAAAGGTAAATATGATAATTACAGACTATTGCATGCCAGGAATGACGGGTTATGAGCTTCTTAAGAAAATTAAGGAATCGGCTATAATGAAGGAAGTTCCAGTTGTTATAATGTCATCTGAGAACATCCCAACTAGAATAAACAAGTGCTTAGAGGAAGGAGCTCAAATGTTCATACTGAAGCCACTGAAACAATCGGACGTGAAGCAATTGAGAGGTCAATTAAACAAATGTGGAAGCTTCTAA

Network for GWHGAAZE003371

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00072.25	Response_reg	26	147	1.90E-22

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	Others

KEGG pathway

KO	Enzyme	pathway	mapID
K14492	ARR-A	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0000160	biological_process	phosphorelay signal transduction system

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.162
	SRR3591706	second leaf	0.289
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	3.680
	SRR3591709	Stem	0.886
	SRR3591710	White floral bud	1.126
	SRR3591711	White flower	0.572
	SRR3591712	Green floral bud	4.427
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	3.891
	SRR8316896	Juvenile bud stage	5.037
	SRR8316897	Juvenile bud stage	2.114
	SRR8316894	Third green stage	1.192
	SRR8316900	Third green stage	10.748
	SRR8316901	Third green stage	8.513
	SRR8316898	Complete white stage	0.357
	SRR8316899	Complete white stage	2.476
	SRR8316903	Complete white stage	0.799
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.132
	SRR8316905	Silver flowering stage	0.072
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.268
	SRR6706287	Light intensity 50%	0.156
	SRR6706288	Light intensity 20%	0.530
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.502
	CNS0095593	Slightly white alabastrum(diploid) 2	3.538
	CNS0095594	Slightly white alabastrum(diploid) 3	15.086
	CNS0095595	Whole white alabastrum(diploid) 2	3.234
	CNS0095596	Whole white alabastrum(diploid) 3	7.647
	CNS0095597	Whole white alabastrum(diploid) 4	4.309
	CNS0095598	Silvery flower (diploied) 1	0.380
	CNS0095599	Silvery flower (diploied) 2	0.221
	CNS0095600	Silvery flower (diploied) 3	0.477
	CNS0095601	Golden flower (diploid) 1	0.097
	CNS0095602	Golden flower (diploid) 2	0.866
	CNS0095603	Golden flower (diploid) 3	0.790
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.335
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.157
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.505
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.084
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.338
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.851
	CNS0095610	Silvery flower (tetraploid) 1	0.144
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.170
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.675
	CRR073298	Stem 2	1.333
	CRR073299	Stem 3	1.715
	CRR073300	Leaf 1	1.082
	CRR073301	Leaf 2	1.222
	CRR073302	Leaf 3	0.221
	CRR073303	Juvenile bud 1	0.110
	CRR073304	Juvenile bud 2	0.141
	CRR073305	Juvenile bud 3	0.192
	CRR073306	Third green 1	0.304
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.139
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.168
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000