Gene detail

Detail information of GWHGAAZE003416

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011031957.1	3.8668E-120	PREDICTED: GTP-binding protein YPTM2 [Populus euphratica]
COG	YP_008431664.1	1E-18	hypothetical protein N186_01315
Swissprot	tr\|P28188\|RAD2A_ARATH	3E-114	Ras-related protein RABD2a
trEMBL	tr\|A0A067KY70\|A0A067KY70_JATCU	5E-120	Uncharacterized protein {ECO:0000313\|EMBL:KDP39933.1}
TAIR10	AT1G02130.1	3E-90	RAS 5

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	97498496	97501212	+
GWHAAZE00000001	mRNA	97498496	97501212	+
GWHAAZE00000001	exon	97498496	97498567	+
GWHAAZE00000001	exon	97499808	97499855	+
GWHAAZE00000001	exon	97500363	97500434	+
GWHAAZE00000001	exon	97500566	97500721	+
GWHAAZE00000001	exon	97500899	97501002	+
GWHAAZE00000001	exon	97501116	97501212	+
GWHAAZE00000001	CDS	97498496	97498567	+
GWHAAZE00000001	CDS	97499808	97499855	+
GWHAAZE00000001	CDS	97500363	97500434	+
GWHAAZE00000001	CDS	97500566	97500721	+
GWHAAZE00000001	CDS	97500899	97501002	+
GWHAAZE00000001	CDS	97501116	97501212	+

Transcript Sequence
>GWHTAAZE003422 GATTACCTGTTCAAACTTTTGCTAATTGGAGATTCCGGAGTTGGGAAATCATGTCTTCTTCTGAGATTTTCTGATGACTCATATCTGGAGAGTTACATTAGCACAATTGGTGTTGACTTTTGGGATACGGCTGGACAAGAACGGTTCAGGACAATAACTAGTAGCTACTACCGTGGGGCACATGGCATTATTGTAGTTTATGATGTAACTGACCAAGATAGCTTCAACAATGTTAAGCAATGGCTGAGCGAAATTGATCGCTATGCAAGTGAAAATGTAAACAAGCTTCTTGTTGGAAACAAATGCGACCTTACTGATAAAAGAGTGGTGTCCTATGAAACAGGCAAGGCGCTTGCAGATGAAATTGGAATTCCATTCATAGAGACCAGTGCAAAAAACGCCACTAACGTCGAGCAGGCTTTTATGGCTATGTCTGCTGATATCAAGAATAGGATGGCAAGTCAACCCGGAATGAACAATGCGAGGACACCAACGGTGCAGATAAAGGGGCAACCTGTTAACCAGAAGACTGGTTGCTGCTCTTCTTGA

Network for GWHGAAZE003416

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00071.23	Ras	5	149	1.10E-53

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07874	RAB1A	Autophagy - animal	map04140

Gene Ontology

GO term	Ontology	Name
GO:0005525	molecular_function	GTP binding
GO:0003924	molecular_function	GTPase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.459
	SRR8316896	Juvenile bud stage	1.393
	SRR8316897	Juvenile bud stage	5.185
	SRR8316894	Third green stage	0.603
	SRR8316900	Third green stage	2.122
	SRR8316901	Third green stage	1.482
	SRR8316898	Complete white stage	0.036
	SRR8316899	Complete white stage	0.780
	SRR8316903	Complete white stage	0.196
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.329
	SRR8316905	Silver flowering stage	0.071
	SRR8316906	Gold flowering stage	0.746
	SRR8316907	Gold flowering stage	1.652
	SRR8316908	Gold flowering stage	11.615
SRP132670	SRR6706286	Control	0.944
	SRR6706287	Light intensity 50%	0.753
	SRR6706288	Light intensity 20%	1.072
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.278
	CNS0095593	Slightly white alabastrum(diploid) 2	3.432
	CNS0095594	Slightly white alabastrum(diploid) 3	3.076
	CNS0095595	Whole white alabastrum(diploid) 2	1.647
	CNS0095596	Whole white alabastrum(diploid) 3	2.638
	CNS0095597	Whole white alabastrum(diploid) 4	3.483
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	1.942
	CNS0095600	Silvery flower (diploied) 3	0.532
	CNS0095601	Golden flower (diploid) 1	2.229
	CNS0095602	Golden flower (diploid) 2	0.628
	CNS0095603	Golden flower (diploid) 3	0.460
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.499
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.723
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.370
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.603
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.813
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.007
	CNS0095610	Silvery flower (tetraploid) 1	0.728
	CNS0095611	Silvery flower (tetraploid) 2	0.212
	CNS0095612	Silvery flower (tetraploid) 3	0.615
	CNS0095613	Golden flower (tetraploid) 1	0.910
	CNS0095614	Golden flower (tetraploid) 2	0.509
	CNS0095615	Golden flower (tetraploid) 3	0.165
CRA001975	CRR073297	Stem 1	0.047
	CRR073298	Stem 2	0.348
	CRR073299	Stem 3	0.206
	CRR073300	Leaf 1	0.906
	CRR073301	Leaf 2	0.585
	CRR073302	Leaf 3	0.078
	CRR073303	Juvenile bud 1	0.188
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.007
	CRR073306	Third green 1	0.251
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.008
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.037
	CRR073311	Second white 3	0.143
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.131
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.172
	CRR073319	Tawny withering 2	0.100
	CRR073320	Tawny withering 3	0.130