Gene detail

Detail information of GWHGAAZE003501

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011030036.1	7.10832E-87	PREDICTED: dehydration-responsive element-binding protein 1A [Populus euphratica]
Swissprot	tr\|Q9SYS6\|DRE1C_ARATH	5E-68	Dehydration-responsive element-binding protein 1C
trEMBL	tr\|V9PCH8\|V9PCH8_POPEU	1E-86	C-repeat binding factor 4b {ECO:0000313\|EMBL:AGY31291.1}
TAIR10	AT4G25480.1	8E-39	dehydration response element B1A

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	99096148	99096840	-
GWHAAZE00000001	mRNA	99096148	99096840	-
GWHAAZE00000001	exon	99096148	99096840	-
GWHAAZE00000001	CDS	99096148	99096840	-

Transcript Sequence
>GWHTAAZE003507 ATGGAAAATTTCTCCCCTCATTCTAACCCACTTCAGTTTAGTTCTTCTGATGTATCTTCACCTCAAATTGCTTATTCATCATCGGCCTCAGATGCTACTAGTACAGTCCGTAGAACATTTTTTCCGTACAAGGAGGTGATCTTGGCTTCTAGCAACCCGAAGAAGCGTGCAGGACGAAAAAAGTTTAGGGAGACTAGGCACCCAGTGTACAGGGGCGTAAGGAAGAGGAACTCCGGCAAGTGGGTATGTGAGGTTAGAGAACCCAACAAGAAGTCTAGAATATGGCTTGGGACACACGAGACTGCTGACATGGCTGCTAGAGCTCATGACGTGGCGGCTATTGCTCTTAGGGGACGGTCCGCTTGCATCAACTTTGCTGACTCCATGTGGCGGCTTCCCATTCCCGCATCCAATGATGTCAAGGATATTCAGAGGGCAGCAGCTGAGGCAGCTGAAAGGTTTCGGCCATCTAATCAATCTAACGTGGCCCCAGGAGATGATGTGGTTGAGGAAAGTGCCACATCATTGCCGGAAAATGTGTTTTACGACGAGGCGTTGTTTGGCATGCGGGAGTTGCTTGCGGAAATGGCAGAAGGGTTGATGCTACCTCCACCTCATTGTGGTGGAGATGAGTATGTCGCAGAAGACGGGGAAATTAATGATGAGATGTTCTTGTGGAGTTACTCTGTTTGA

Network for GWHGAAZE003501

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	68	118	6.40E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.625
	SRR3591706	second leaf	0.120
	SRR3591707	mature leaf	0.272
	SRR3591708	Shoot apex	0.089
	SRR3591709	Stem	1.930
	SRR3591710	White floral bud	0.727
	SRR3591711	White flower	3.486
	SRR3591712	Green floral bud	2.500
	SRR3591713	Yellow flower	2.366
SRP173429	SRR8316895	Juvenile bud stage	1.238
	SRR8316896	Juvenile bud stage	3.170
	SRR8316897	Juvenile bud stage	1.439
	SRR8316894	Third green stage	0.221
	SRR8316900	Third green stage	0.124
	SRR8316901	Third green stage	0.413
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.957
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.054
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.347
	CNS0095593	Slightly white alabastrum(diploid) 2	0.553
	CNS0095594	Slightly white alabastrum(diploid) 3	2.292
	CNS0095595	Whole white alabastrum(diploid) 2	0.227
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.816
	CNS0095598	Silvery flower (diploied) 1	5.950
	CNS0095599	Silvery flower (diploied) 2	3.179
	CNS0095600	Silvery flower (diploied) 3	0.518
	CNS0095601	Golden flower (diploid) 1	0.051
	CNS0095602	Golden flower (diploid) 2	1.247
	CNS0095603	Golden flower (diploid) 3	0.540
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.010
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.484
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.102
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.242
	CRR073300	Leaf 1	0.844
	CRR073301	Leaf 2	0.720
	CRR073302	Leaf 3	0.119
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	1.885
	CRR073306	Third green 1	0.289
	CRR073307	Third green 2	0.377
	CRR073308	Third green 3	0.324
	CRR073309	Second white 1	0.198
	CRR073310	Second white 2	0.517
	CRR073311	Second white 3	0.119
	CRR073312	Silver flowering 1	2.493
	CRR073313	Silver flowering 2	1.860
	CRR073314	Silver flowering 3	0.206
	CRR073315	Gold flowering 1	0.248
	CRR073316	Gold flowering 2	0.151
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.577
	CRR073320	Tawny withering 3	0.079