Gene detail

Detail information of GWHGAAZE003502

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AFQ59977.1	1.58913E-96	CRT/DRE binding factor 1 [Morus alba var. multicaulis]
Swissprot	tr\|Q9SYS6\|DRE1C_ARATH	6E-76	Dehydration-responsive element-binding protein 1C
trEMBL	tr\|J7K128\|J7K128_MORAL	6E-97	CRT/DRE binding factor 1 {ECO:0000313\|EMBL:AFQ59977.1}
TAIR10	AT4G25470.1	5E-58	C-repeat/DRE binding factor 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	99131277	99131957	-
GWHAAZE00000001	mRNA	99131277	99131957	-
GWHAAZE00000001	exon	99131277	99131957	-
GWHAAZE00000001	CDS	99131277	99131957	-

Transcript Sequence
>GWHTAAZE003508 ATGGAAAATTTCTCCCCTCATTCTGACACACATCAGTTTAGTTCCCCTCAACTCAATACATCATCGACCTCAGATGCTACCAGTAGCGTCCGCAGAGCAAATTTTTCGGATGACGAGGTGATCTTGGCTTCTAGCAACCCAAAGAAGCGTGCAGGTCGAAAAAAGTTCAAGGAGACTAGGCACCCTGTATACAGGGGCGTAAGGAAGAGAAACTCCGGCAAGTGGGTCTGTGAGGTGAGAGAACCCAACAAGAAGTCTAGAATATGGCTCGGGACACACGAGACTGCTGAGATGGCTGCTAGAGCTCATGATGTGGCAGCTATCGCTCTTAGGGGACGGTCGGCTTGCCTCAACTTTGCTGACTCCACGTGGCGGCTTCCCATTCCCGCGTCCAATGATGTCAAGGATATTCAAAGGGCGGCAGCTGAGGCAGCTGAAAGGTTTCGGCCATCTGATCAACCTGAGGTGCCCTCCGGAGATGACGTGGCTGAGGAAAGTGCCGCATCATTGCCGGAAGATGTGTTTTACACGGATGAAGAGGCAGTGTTTGGTATGCGGGAGTTGCTTGACAATATGGCAGAAGGGTTGATGCTACCTCCCCCTCCAAGTGGTGGAGATGGGAATGTAGAAGATGACGTGGACGCCCGTGCTGACATGTCCTTGTGGAGTTACTCCATTTGA

Network for GWHGAAZE003502

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	62	112	8.10E-15

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.348
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.148
	SRR3591709	Stem	0.493
	SRR3591710	White floral bud	0.301
	SRR3591711	White flower	0.542
	SRR3591712	Green floral bud	2.785
	SRR3591713	Yellow flower	0.235
SRP173429	SRR8316895	Juvenile bud stage	1.191
	SRR8316896	Juvenile bud stage	2.535
	SRR8316897	Juvenile bud stage	0.823
	SRR8316894	Third green stage	0.174
	SRR8316900	Third green stage	0.219
	SRR8316901	Third green stage	0.763
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.417
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.082
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.019
	CNS0095593	Slightly white alabastrum(diploid) 2	2.108
	CNS0095594	Slightly white alabastrum(diploid) 3	4.807
	CNS0095595	Whole white alabastrum(diploid) 2	3.585
	CNS0095596	Whole white alabastrum(diploid) 3	0.496
	CNS0095597	Whole white alabastrum(diploid) 4	2.342
	CNS0095598	Silvery flower (diploied) 1	1.598
	CNS0095599	Silvery flower (diploied) 2	3.239
	CNS0095600	Silvery flower (diploied) 3	0.929
	CNS0095601	Golden flower (diploid) 1	1.273
	CNS0095602	Golden flower (diploid) 2	1.283
	CNS0095603	Golden flower (diploid) 3	0.886
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.095
	CNS0095611	Silvery flower (tetraploid) 2	0.015
	CNS0095612	Silvery flower (tetraploid) 3	0.195
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.085
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.328
	CRR073299	Stem 3	0.044
	CRR073300	Leaf 1	0.338
	CRR073301	Leaf 2	1.416
	CRR073302	Leaf 3	0.560
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.399
	CRR073305	Juvenile bud 3	0.524
	CRR073306	Third green 1	0.154
	CRR073307	Third green 2	0.080
	CRR073308	Third green 3	0.115
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.542
	CRR073313	Silver flowering 2	0.084
	CRR073314	Silver flowering 3	0.211
	CRR073315	Gold flowering 1	0.012
	CRR073316	Gold flowering 2	0.831
	CRR073317	Gold flowering 3	0.129
	CRR073318	Tawny withering 1	0.058
	CRR073319	Tawny withering 2	3.351
	CRR073320	Tawny withering 3	0.000