Gene detail

Detail information of GWHGAAZE003545

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011084418.1	4.69303E-83	PREDICTED: actin-depolymerizing factor 7 [Sesamum indicum]
Swissprot	tr\|Q67ZM4\|ADF7_ARATH	5E-84	Actin-depolymerizing factor 7
trEMBL	tr\|B9I489\|B9I489_POPTR	3E-83	Actin-depolymerizing factor family protein {ECO:0000313\|EMBL:EEE96457.1}
TAIR10	AT4G25590.1	3E-66	actin depolymerizing factor 7

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	99780144	99781363	-
GWHAAZE00000001	mRNA	99780144	99781363	-
GWHAAZE00000001	exon	99780144	99780294	-
GWHAAZE00000001	exon	99780461	99780720	-
GWHAAZE00000001	exon	99781319	99781363	-
GWHAAZE00000001	CDS	99781319	99781363	-
GWHAAZE00000001	CDS	99780461	99780720	-
GWHAAZE00000001	CDS	99780144	99780294	-

Transcript Sequence
>GWHTAAZE003551 ATGGATGACGGATGGAAAATGAGGAAGTGGCTAGTTGTTCATCGATCCAATGCGGCATCTGGAATGGCTGTGGACGATGAGTGTAAGCTCAAGTTCTTGGAATTAAAATCAAAGAGGAACTACCGATTCATTATCTATAAGATTGAGAGCCAACAAGTGATTGTAGAGAAGCTTGGGGGTCCTGGTGAAAGCTATGAAAATTTCACCTCCTCTCTGCCCGCTGATGAGTGCCGCTATGCTGTCTTTGATTTTGATTTCACTACTGACGAGAATTGCCAGAAGAGCAAGATCTTTTTTATTGCTTGGTCTCCGGACACATCAAAGGTGAGAATGAAGATGGTGTATGCAAGCTCCAAGGATAGATTCAAGCGAGAGCTGGACGGAATCCAATTTGAGTTGCAAGCAACAGATCCCAGTGAGATGAGCCTCGACATTGTAAAAGGGCGAGCAATCTAA

Network for GWHGAAZE003545

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00241.21	Cofilin_ADF	28	147	7.60E-37

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05765	CFL	Regulation of actin cytoskeleton	map04810
		Fc gamma R-mediated phagocytosis	map04666
		Axon guidance	map04360

Gene Ontology

GO term	Ontology	Name
GO:0030042	biological_process	actin filament depolymerization
GO:0015629	cellular_component	actin cytoskeleton
GO:0003779	molecular_function	actin binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.791
	SRR3591706	second leaf	0.115
	SRR3591707	mature leaf	0.577
	SRR3591708	Shoot apex	0.109
	SRR3591709	Stem	0.663
	SRR3591710	White floral bud	72.399
	SRR3591711	White flower	2.966
	SRR3591712	Green floral bud	121.938
	SRR3591713	Yellow flower	2.100
SRP173429	SRR8316895	Juvenile bud stage	8.731
	SRR8316896	Juvenile bud stage	19.473
	SRR8316897	Juvenile bud stage	7.017
	SRR8316894	Third green stage	9.747
	SRR8316900	Third green stage	106.683
	SRR8316901	Third green stage	83.343
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.441
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	1.251
	SRR8316904	Silver flowering stage	4.082
	SRR8316905	Silver flowering stage	1.308
	SRR8316906	Gold flowering stage	6.322
	SRR8316907	Gold flowering stage	10.246
	SRR8316908	Gold flowering stage	2.224
SRP132670	SRR6706286	Control	49.928
	SRR6706287	Light intensity 50%	44.640
	SRR6706288	Light intensity 20%	42.605
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	36.754
	CNS0095593	Slightly white alabastrum(diploid) 2	26.051
	CNS0095594	Slightly white alabastrum(diploid) 3	29.901
	CNS0095595	Whole white alabastrum(diploid) 2	82.566
	CNS0095596	Whole white alabastrum(diploid) 3	122.740
	CNS0095597	Whole white alabastrum(diploid) 4	103.367
	CNS0095598	Silvery flower (diploied) 1	2.301
	CNS0095599	Silvery flower (diploied) 2	7.523
	CNS0095600	Silvery flower (diploied) 3	2.339
	CNS0095601	Golden flower (diploid) 1	2.226
	CNS0095602	Golden flower (diploid) 2	1.238
	CNS0095603	Golden flower (diploid) 3	1.995
	CNS0095604	Slightly white alabastrum(tetraploid) 1	87.491
	CNS0095605	Slightly white alabastrum(tetraploid) 2	73.393
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.188
	CNS0095607	Whole white alabastrum(tetraploid) 1	189.216
	CNS0095608	Whole white alabastrum(tetraploid) 2	248.543
	CNS0095609	Whole white alabastrum(tetraploid) 3	151.065
	CNS0095610	Silvery flower (tetraploid) 1	0.765
	CNS0095611	Silvery flower (tetraploid) 2	9.424
	CNS0095612	Silvery flower (tetraploid) 3	24.486
	CNS0095613	Golden flower (tetraploid) 1	1.593
	CNS0095614	Golden flower (tetraploid) 2	0.979
	CNS0095615	Golden flower (tetraploid) 3	14.567
CRA001975	CRR073297	Stem 1	9.176
	CRR073298	Stem 2	8.460
	CRR073299	Stem 3	12.702
	CRR073300	Leaf 1	43.200
	CRR073301	Leaf 2	36.159
	CRR073302	Leaf 3	29.721
	CRR073303	Juvenile bud 1	50.928
	CRR073304	Juvenile bud 2	66.672
	CRR073305	Juvenile bud 3	4.875
	CRR073306	Third green 1	21.529
	CRR073307	Third green 2	34.767
	CRR073308	Third green 3	27.163
	CRR073309	Second white 1	5.056
	CRR073310	Second white 2	6.281
	CRR073311	Second white 3	10.545
	CRR073312	Silver flowering 1	25.723
	CRR073313	Silver flowering 2	31.124
	CRR073314	Silver flowering 3	15.392
	CRR073315	Gold flowering 1	25.027
	CRR073316	Gold flowering 2	5.529
	CRR073317	Gold flowering 3	15.657
	CRR073318	Tawny withering 1	22.028
	CRR073319	Tawny withering 2	18.392
	CRR073320	Tawny withering 3	16.644