Gene detail

Detail information of GWHGAAZE003598

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP05129.1	1.38453E-98	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9FLX7\|NDUA5_ARATH	2E-86	Probable NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 5, mitochondrial (Precursor)
trEMBL	tr\|A0A068UAA7\|A0A068UAA7_COFCA	5E-99	Coffea canephora DH200=94 genomic scaffold, scaffold_15 {ECO:0000313\|EMBL:CDP05129.1}
TAIR10	AT5G52840.1	1E-68	NADH-ubiquinone oxidoreductase-related

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	100707038	100710755	+
GWHAAZE00000001	mRNA	100707038	100710755	+
GWHAAZE00000001	exon	100707038	100707356	+
GWHAAZE00000001	exon	100710532	100710755	+
GWHAAZE00000001	CDS	100707038	100707356	+
GWHAAZE00000001	CDS	100710532	100710755	+

Transcript Sequence
>GWHTAAZE003604 ATGTTCCTCCGGAGGTTTTCGAGGCCATTGATGATGATGGCGAAGGTGAAAGAGACGACGGGGATCGTAGGTCTAGAGGTAGTGCCGAACGCGAGGGAGGTGCTGATCAATCTCTACAACAAAGCCCTAAAGGAGATCAAGGCTGTACCAGAGAACGAGGGGTATCGTAAGGCAGTTGAGAGTTTCACCACCCACCGACTCAAGGTCTGCCAGGAGGAACAAGACTGGGAAATGATTGAGAAGCGTCTTGGTTGCGGTCAGGTCGAAGAGCTCATCGAAGAGGCCCAAGACGAGCTCAAACTCATCGACAAAATGATCGAGTGGGACCCCTGGATAGTTCCGGAAGACTATGAATGTGAAGTTATAGAGAATAATGCTCCAGTTCCAAAGCACGTACCCCTACATCGGCCAGGTCCTCTTCCGGAGGAGTTCTACAAGACGTTGGAAGCTGTTAATTCAGACACCCTTGATGCCTTTGTTGCACTGACTAAACAGGAGCAGCCTGGAATTTCCTCCTCTAGTGAGGCCCCCCAGTCAAAGTAA

Network for GWHGAAZE003598

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04716.15	ETC_C1_NDUFA5	24	90	2.80E-25

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03949	NDUFA5	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Retrograde endocannabinoid signaling	map04723
		Thermogenesis	map04714

Gene Ontology

GO term	Ontology	Name
GO:0022904	biological_process	respiratory electron transport chain
GO:0005747	cellular_component	mitochondrial respiratory chain complex I

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	151.715
	SRR3591706	second leaf	50.410
	SRR3591707	mature leaf	36.792
	SRR3591708	Shoot apex	118.112
	SRR3591709	Stem	106.127
	SRR3591710	White floral bud	87.863
	SRR3591711	White flower	96.891
	SRR3591712	Green floral bud	110.020
	SRR3591713	Yellow flower	89.379
SRP173429	SRR8316895	Juvenile bud stage	107.856
	SRR8316896	Juvenile bud stage	148.534
	SRR8316897	Juvenile bud stage	34.581
	SRR8316894	Third green stage	48.052
	SRR8316900	Third green stage	215.525
	SRR8316901	Third green stage	231.759
	SRR8316898	Complete white stage	82.228
	SRR8316899	Complete white stage	164.463
	SRR8316903	Complete white stage	88.714
	SRR8316902	Silver flowering stage	87.674
	SRR8316904	Silver flowering stage	73.694
	SRR8316905	Silver flowering stage	45.764
	SRR8316906	Gold flowering stage	148.474
	SRR8316907	Gold flowering stage	186.723
	SRR8316908	Gold flowering stage	109.745
SRP132670	SRR6706286	Control	130.429
	SRR6706287	Light intensity 50%	121.774
	SRR6706288	Light intensity 20%	126.419
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	261.149
	CNS0095593	Slightly white alabastrum(diploid) 2	276.876
	CNS0095594	Slightly white alabastrum(diploid) 3	258.012
	CNS0095595	Whole white alabastrum(diploid) 2	265.062
	CNS0095596	Whole white alabastrum(diploid) 3	313.257
	CNS0095597	Whole white alabastrum(diploid) 4	241.511
	CNS0095598	Silvery flower (diploied) 1	171.891
	CNS0095599	Silvery flower (diploied) 2	208.497
	CNS0095600	Silvery flower (diploied) 3	209.154
	CNS0095601	Golden flower (diploid) 1	198.583
	CNS0095602	Golden flower (diploid) 2	180.849
	CNS0095603	Golden flower (diploid) 3	176.187
	CNS0095604	Slightly white alabastrum(tetraploid) 1	301.821
	CNS0095605	Slightly white alabastrum(tetraploid) 2	299.925
	CNS0095606	Slightly white alabastrum(tetraploid) 3	259.022
	CNS0095607	Whole white alabastrum(tetraploid) 1	287.554
	CNS0095608	Whole white alabastrum(tetraploid) 2	309.465
	CNS0095609	Whole white alabastrum(tetraploid) 3	328.034
	CNS0095610	Silvery flower (tetraploid) 1	294.228
	CNS0095611	Silvery flower (tetraploid) 2	226.898
	CNS0095612	Silvery flower (tetraploid) 3	229.172
	CNS0095613	Golden flower (tetraploid) 1	228.389
	CNS0095614	Golden flower (tetraploid) 2	262.826
	CNS0095615	Golden flower (tetraploid) 3	188.131
CRA001975	CRR073297	Stem 1	179.176
	CRR073298	Stem 2	171.851
	CRR073299	Stem 3	224.495
	CRR073300	Leaf 1	199.699
	CRR073301	Leaf 2	214.263
	CRR073302	Leaf 3	263.521
	CRR073303	Juvenile bud 1	270.237
	CRR073304	Juvenile bud 2	290.140
	CRR073305	Juvenile bud 3	230.534
	CRR073306	Third green 1	225.039
	CRR073307	Third green 2	240.734
	CRR073308	Third green 3	186.569
	CRR073309	Second white 1	255.513
	CRR073310	Second white 2	127.701
	CRR073311	Second white 3	100.507
	CRR073312	Silver flowering 1	131.042
	CRR073313	Silver flowering 2	172.929
	CRR073314	Silver flowering 3	116.649
	CRR073315	Gold flowering 1	88.802
	CRR073316	Gold flowering 2	80.509
	CRR073317	Gold flowering 3	76.759
	CRR073318	Tawny withering 1	164.119
	CRR073319	Tawny withering 2	170.547
	CRR073320	Tawny withering 3	153.542