Gene detail

Detail information of GWHGAAZE003599

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP05129.1	1.38453E-98	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9FLX7\|NDUA5_ARATH	2E-86	Probable NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 5, mitochondrial (Precursor)
trEMBL	tr\|A0A068UAA7\|A0A068UAA7_COFCA	5E-99	Coffea canephora DH200=94 genomic scaffold, scaffold_15 {ECO:0000313\|EMBL:CDP05129.1}
TAIR10	AT5G52840.1	1E-68	NADH-ubiquinone oxidoreductase-related

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	100728109	100731830	+
GWHAAZE00000001	mRNA	100728109	100731830	+
GWHAAZE00000001	exon	100728109	100728427	+
GWHAAZE00000001	exon	100731607	100731830	+
GWHAAZE00000001	CDS	100728109	100728427	+
GWHAAZE00000001	CDS	100731607	100731830	+

Transcript Sequence
>GWHTAAZE003605 ATGTTCCTCCGGAGGTTTTCGAGGCCATTGATGATGATGGCGAAGGTGAAAGAGACGACGGGGATCGTAGGTCTAGAGGTAGTGCCGAACGCGAGGGAGGTGCTGATCAATCTCTACAACAAAGCCCTAAAGGAGATCAAGGCTGTACCAGAGAACGAGGGGTATCGTAAGGCAGTTGAGAGTTTCACCACCCACCGACTCAAGGTCTGCCAGGAGGAACAAGACTGGGAAATGATTGAGAAGCGTCTTGGTTGCGGTCAGGTCGAAGAGCTCATCGAAGAGGCCCAAGACGAGCTCAAACTCATCGACAAAATGATCGAGTGGGACCCCTGGATAGTTCCGGAAGACTATGAATGTGAAGTTATAGAGAATAATGCTCCAGTTCCAAAGCACGTACCCCTACATCGGCCAGGTCCTCTTCCGGAGGAGTTCTACAAGACGTTGGAAGCTGTTAATTCAGACACCCTTGATGCCTTTGTTGCACTGACTAAACAGGAGCAGCCTGGAATTTCCTCCTCTAGTGAGGCCCCCCAGTCAAAGTAA

Network for GWHGAAZE003599

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04716.15	ETC_C1_NDUFA5	24	90	2.80E-25

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03949	NDUFA5	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Retrograde endocannabinoid signaling	map04723
		Thermogenesis	map04714

Gene Ontology

GO term	Ontology	Name
GO:0022904	biological_process	respiratory electron transport chain
GO:0005747	cellular_component	mitochondrial respiratory chain complex I

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	192.328
	SRR3591706	second leaf	64.232
	SRR3591707	mature leaf	48.029
	SRR3591708	Shoot apex	150.143
	SRR3591709	Stem	130.622
	SRR3591710	White floral bud	112.326
	SRR3591711	White flower	122.215
	SRR3591712	Green floral bud	138.941
	SRR3591713	Yellow flower	118.581
SRP173429	SRR8316895	Juvenile bud stage	152.264
	SRR8316896	Juvenile bud stage	224.338
	SRR8316897	Juvenile bud stage	53.547
	SRR8316894	Third green stage	74.075
	SRR8316900	Third green stage	312.760
	SRR8316901	Third green stage	322.839
	SRR8316898	Complete white stage	113.968
	SRR8316899	Complete white stage	285.769
	SRR8316903	Complete white stage	133.689
	SRR8316902	Silver flowering stage	121.898
	SRR8316904	Silver flowering stage	114.692
	SRR8316905	Silver flowering stage	72.636
	SRR8316906	Gold flowering stage	241.392
	SRR8316907	Gold flowering stage	295.363
	SRR8316908	Gold flowering stage	181.446
SRP132670	SRR6706286	Control	316.560
	SRR6706287	Light intensity 50%	301.243
	SRR6706288	Light intensity 20%	322.138
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	307.009
	CNS0095593	Slightly white alabastrum(diploid) 2	322.654
	CNS0095594	Slightly white alabastrum(diploid) 3	299.877
	CNS0095595	Whole white alabastrum(diploid) 2	309.678
	CNS0095596	Whole white alabastrum(diploid) 3	360.084
	CNS0095597	Whole white alabastrum(diploid) 4	287.318
	CNS0095598	Silvery flower (diploied) 1	215.415
	CNS0095599	Silvery flower (diploied) 2	241.729
	CNS0095600	Silvery flower (diploied) 3	251.440
	CNS0095601	Golden flower (diploid) 1	240.805
	CNS0095602	Golden flower (diploid) 2	223.292
	CNS0095603	Golden flower (diploid) 3	221.845
	CNS0095604	Slightly white alabastrum(tetraploid) 1	362.756
	CNS0095605	Slightly white alabastrum(tetraploid) 2	356.195
	CNS0095606	Slightly white alabastrum(tetraploid) 3	312.933
	CNS0095607	Whole white alabastrum(tetraploid) 1	329.417
	CNS0095608	Whole white alabastrum(tetraploid) 2	355.937
	CNS0095609	Whole white alabastrum(tetraploid) 3	388.496
	CNS0095610	Silvery flower (tetraploid) 1	359.093
	CNS0095611	Silvery flower (tetraploid) 2	271.783
	CNS0095612	Silvery flower (tetraploid) 3	281.379
	CNS0095613	Golden flower (tetraploid) 1	264.701
	CNS0095614	Golden flower (tetraploid) 2	322.474
	CNS0095615	Golden flower (tetraploid) 3	229.144
CRA001975	CRR073297	Stem 1	221.863
	CRR073298	Stem 2	217.360
	CRR073299	Stem 3	277.365
	CRR073300	Leaf 1	248.266
	CRR073301	Leaf 2	270.769
	CRR073302	Leaf 3	318.058
	CRR073303	Juvenile bud 1	339.041
	CRR073304	Juvenile bud 2	370.669
	CRR073305	Juvenile bud 3	281.731
	CRR073306	Third green 1	282.691
	CRR073307	Third green 2	299.181
	CRR073308	Third green 3	229.794
	CRR073309	Second white 1	291.722
	CRR073310	Second white 2	144.117
	CRR073311	Second white 3	108.551
	CRR073312	Silver flowering 1	146.973
	CRR073313	Silver flowering 2	197.376
	CRR073314	Silver flowering 3	127.065
	CRR073315	Gold flowering 1	94.607
	CRR073316	Gold flowering 2	94.818
	CRR073317	Gold flowering 3	88.052
	CRR073318	Tawny withering 1	179.739
	CRR073319	Tawny withering 2	181.539
	CRR073320	Tawny withering 3	166.386