Gene detail

Detail information of GWHGAAZE003650

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009141975.1	1.06607E-14	PREDICTED: dipeptidyl peptidase 8 [Brassica rapa]
trEMBL	tr\|M4ECF4\|M4ECF4_BRARP	4E-15	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Bra026463.1-P}
TAIR10	AT5G24260.1	1E-13	prolyl oligopeptidase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	101643639	101644974	-
GWHAAZE00000001	mRNA	101643639	101644974	-
GWHAAZE00000001	exon	101643639	101643756	-
GWHAAZE00000001	exon	101644023	101644128	-
GWHAAZE00000001	exon	101644767	101644974	-
GWHAAZE00000001	CDS	101644767	101644974	-
GWHAAZE00000001	CDS	101644023	101644128	-
GWHAAZE00000001	CDS	101643639	101643756	-

Transcript Sequence
>GWHTAAZE003656 ATGGAATGGAGGAATAGCTACTGGTGGTCATTGGACAGCAAATTCATAGCATTCACACAGGTCAATTCATCAAACATACCTCTTTTCAGAATCATGCACCAGGGTAAAAGTAATGTCGGTGCCGGGCACATGAAGACCATGCTTACCCTTTGCTGGGGCATCAAATGTCAAAGTTCGCCTTGGTGTGGTTTATTCCTCTGGAGGTTTGCTCCAAGATTTAAAAAGCTCCAACGTGAACCTTCTCCAGAATTAGTTCAGATGGCCAAGGATGGGACCATTCTGTATGGGTCATTGTATAAACCCAATTTAGCTAGGGGAACTGCTCGATGCGGTCTAAAGTTTGAAGGTGCTCTAAAGTACAACTGTGGCCGTATTGACATGGAGGATCAACCGGCTGAGGGCCGAATGGCTCGTGAAACAAGGGTTATGTGA

Network for GWHGAAZE003650

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00930.22	DPPIV_N	3	37	1.80E-06

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01278	DPP4, CD26	Protein digestion and absorption	map04974

Gene Ontology

GO term	Ontology	Name
GO:0006508	biological_process	proteolysis

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.005
	SRR8316896	Juvenile bud stage	0.042
	SRR8316897	Juvenile bud stage	0.023
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.128
	SRR8316901	Third green stage	0.091
	SRR8316898	Complete white stage	0.013
	SRR8316899	Complete white stage	0.074
	SRR8316903	Complete white stage	0.020
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.061
	SRR8316905	Silver flowering stage	0.003
	SRR8316906	Gold flowering stage	0.054
	SRR8316907	Gold flowering stage	0.076
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.045
	SRR6706287	Light intensity 50%	0.031
	SRR6706288	Light intensity 20%	0.032
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.161
	CNS0095593	Slightly white alabastrum(diploid) 2	0.091
	CNS0095594	Slightly white alabastrum(diploid) 3	0.223
	CNS0095595	Whole white alabastrum(diploid) 2	0.015
	CNS0095596	Whole white alabastrum(diploid) 3	0.377
	CNS0095597	Whole white alabastrum(diploid) 4	0.091
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.114
	CNS0095600	Silvery flower (diploied) 3	0.101
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.011
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.221
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.183
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.395
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.198
	CNS0095611	Silvery flower (tetraploid) 2	0.053
	CNS0095612	Silvery flower (tetraploid) 3	0.405
	CNS0095613	Golden flower (tetraploid) 1	0.008
	CNS0095614	Golden flower (tetraploid) 2	0.036
	CNS0095615	Golden flower (tetraploid) 3	0.036
CRA001975	CRR073297	Stem 1	0.046
	CRR073298	Stem 2	0.009
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.084
	CRR073301	Leaf 2	0.022
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.033
	CRR073306	Third green 1	0.028
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.028
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.022
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.076
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.037