Gene detail

Detail information of GWHGAAZE003720

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AIU98520.1	4.0549E-178	WD40 protein [Paeonia suffruticosa]
COG	YP_007036119.1	2E-10	hypothetical protein BN6_19260
Swissprot	tr\|Q9XGN1\|TTG1_ARATH	1E-163	Protein TRANSPARENT TESTA GLABRA 1
trEMBL	tr\|A0A067LCP7\|A0A067LCP7_JATCU	2E-173	Uncharacterized protein {ECO:0000313\|EMBL:KDP45023.1}
TAIR10	AT5G24520.3	2E-130	Transducin/WD40 repeat-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	102863439	102864215	+
GWHAAZE00000001	mRNA	102863439	102864215	+
GWHAAZE00000001	exon	102863439	102864215	+
GWHAAZE00000001	CDS	102863439	102864215	+

Transcript Sequence
>GWHTAAZE003726 ATGTTCCACCCTAACTCCTCGGCCTCTCTCCGCAAGTCCTCCGACCTCCTCGCCTCCTCCGGCGACTTCCTCCGTCTCTGGGAAGTCAGGGATAATTCCATCGAATCCATCTCCGTCCTCAACAACAGCAAAACCAGCGAATTCTGCGCCCCTTTGACCTCATTCGATTGGAACGAGGTTGAGCCTCGCAGGATAGGAACCTCCAGCATTGACACAACCTGCACTATTTGGGATGTGGAGAGAGGGGTCGTCGAGACTCAATTAATCGCTCACGATAAGGAAGTTCACGATATTGCTTGGGGGGAAGCTGGGGTTTTTGCTTCCGTTTCCGCTGACGGTTCTGTCAGGATTTTCGATTTGCGCGATAAGGAGCATTCGACAATCATATACGAGAGTCCACAACCGGATACTCCGTTGCTTAGGTTGGCTTGGAACAAGCAGGATTTGAGGTACATGGCTACCATTTTGATGGATAGTAATAAAGTTGTGATATTGGATATTCGATCCCCCACAATGCCTGTAGCTGAGTTGGAGAGGCATCGTTCCAGTGTGAATGCCATTGCTTGGGCCCCCCTCAGTTGTCGCCACATATGTTCGGCTGGGGATGATTCACAGGCCCTCATTTGGGAGTTGCCCACCGTGGCCGGTCCTAACGGAATTGATCCTATGTCTATGTTTTCCGCCGGTTCTGAAATTAACCAGCTCCAGTGGTCACCAGCACAGCCTGATTGGATTGCTATTGCCTTTTCCAACAAAATGCAGCTTTTGAAAGTTTAG

Network for GWHGAAZE003720

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0025

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00400.33	WD40	88	119	0.022
PF00400.33	WD40	174	209	0.19

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	DWD

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	21.243
	SRR3591706	second leaf	16.088
	SRR3591707	mature leaf	20.720
	SRR3591708	Shoot apex	20.710
	SRR3591709	Stem	28.695
	SRR3591710	White floral bud	22.702
	SRR3591711	White flower	29.601
	SRR3591712	Green floral bud	29.843
	SRR3591713	Yellow flower	20.634
SRP173429	SRR8316895	Juvenile bud stage	14.996
	SRR8316896	Juvenile bud stage	15.251
	SRR8316897	Juvenile bud stage	11.429
	SRR8316894	Third green stage	10.414
	SRR8316900	Third green stage	19.602
	SRR8316901	Third green stage	21.477
	SRR8316898	Complete white stage	4.699
	SRR8316899	Complete white stage	27.320
	SRR8316903	Complete white stage	9.036
	SRR8316902	Silver flowering stage	3.572
	SRR8316904	Silver flowering stage	5.955
	SRR8316905	Silver flowering stage	2.787
	SRR8316906	Gold flowering stage	9.073
	SRR8316907	Gold flowering stage	6.652
	SRR8316908	Gold flowering stage	12.562
SRP132670	SRR6706286	Control	14.231
	SRR6706287	Light intensity 50%	14.220
	SRR6706288	Light intensity 20%	14.722
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	19.620
	CNS0095593	Slightly white alabastrum(diploid) 2	20.031
	CNS0095594	Slightly white alabastrum(diploid) 3	21.369
	CNS0095595	Whole white alabastrum(diploid) 2	16.099
	CNS0095596	Whole white alabastrum(diploid) 3	10.209
	CNS0095597	Whole white alabastrum(diploid) 4	14.331
	CNS0095598	Silvery flower (diploied) 1	17.906
	CNS0095599	Silvery flower (diploied) 2	17.863
	CNS0095600	Silvery flower (diploied) 3	16.035
	CNS0095601	Golden flower (diploid) 1	19.676
	CNS0095602	Golden flower (diploid) 2	19.718
	CNS0095603	Golden flower (diploid) 3	19.941
	CNS0095604	Slightly white alabastrum(tetraploid) 1	14.210
	CNS0095605	Slightly white alabastrum(tetraploid) 2	14.115
	CNS0095606	Slightly white alabastrum(tetraploid) 3	24.470
	CNS0095607	Whole white alabastrum(tetraploid) 1	10.729
	CNS0095608	Whole white alabastrum(tetraploid) 2	10.094
	CNS0095609	Whole white alabastrum(tetraploid) 3	15.092
	CNS0095610	Silvery flower (tetraploid) 1	16.580
	CNS0095611	Silvery flower (tetraploid) 2	25.617
	CNS0095612	Silvery flower (tetraploid) 3	13.173
	CNS0095613	Golden flower (tetraploid) 1	13.545
	CNS0095614	Golden flower (tetraploid) 2	18.777
	CNS0095615	Golden flower (tetraploid) 3	11.110
CRA001975	CRR073297	Stem 1	26.483
	CRR073298	Stem 2	22.232
	CRR073299	Stem 3	32.074
	CRR073300	Leaf 1	29.303
	CRR073301	Leaf 2	29.160
	CRR073302	Leaf 3	26.258
	CRR073303	Juvenile bud 1	28.336
	CRR073304	Juvenile bud 2	25.173
	CRR073305	Juvenile bud 3	48.127
	CRR073306	Third green 1	3.031
	CRR073307	Third green 2	4.640
	CRR073308	Third green 3	2.840
	CRR073309	Second white 1	6.777
	CRR073310	Second white 2	4.625
	CRR073311	Second white 3	4.181
	CRR073312	Silver flowering 1	4.441
	CRR073313	Silver flowering 2	7.308
	CRR073314	Silver flowering 3	11.622
	CRR073315	Gold flowering 1	17.926
	CRR073316	Gold flowering 2	18.830
	CRR073317	Gold flowering 3	21.318
	CRR073318	Tawny withering 1	31.225
	CRR073319	Tawny withering 2	42.331
	CRR073320	Tawny withering 3	36.426