Gene detail

Detail information of GWHGAAZE003730

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008437538.1	4.4286E-127	PREDICTED: 60S ribosomal protein L9 [Cucumis melo]
COG	YP_001013491.1	2E-44	50S ribosomal protein L6P
Swissprot	tr\|P49209\|RL91_ARATH	2E-121	60S ribosomal protein L9-1
trEMBL	tr\|E5GBD5\|E5GBD5_CUCME	2E-127	60S ribosomal protein l9 {ECO:0000313\|EMBL:ADN33776.1}
TAIR10	AT1G33140.1	1E-95	Ribosomal protein L6 family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	103041275	103043436	+
GWHAAZE00000001	mRNA	103041275	103043436	+
GWHAAZE00000001	exon	103041275	103041649	+
GWHAAZE00000001	exon	103043125	103043247	+
GWHAAZE00000001	exon	103043350	103043436	+
GWHAAZE00000001	CDS	103041275	103041649	+
GWHAAZE00000001	CDS	103043125	103043247	+
GWHAAZE00000001	CDS	103043350	103043436	+

Transcript Sequence
>GWHTAAZE003736 ATGAAGACTATTCTGTCGTCGGAGACCATGGACATTCCAGACGGGGTGAAGATAAAGGTGAAGGCAAAAATGATTGAAGTGGAGGGACCGAGAGGGAAGCTCACCCGCAACTTCAAGCATCTGAACCTGGATTTCCAGCTCATCACCGACGAGGAGACCGGACAGAAGAAGCTCAAGGTAGACGCCTGGTTCGGATCTCGCAAGACCACCGCCGCCATTCGCACAGCCCTCAGCCACGTTGGCAACCTCATCAACGGCGTCACCAAGGGTTACCGCTACAAGATGCGTTTCGTCTATGCTCACTTTCCTATCAACGCCAGCATCGGCAACGATGGCAAGTCTATCGAGATCCGTAATTTCCTTGGCGAAAAGAAGGTGAGGAAAGTGCAAATGCTTGATGGTGTTTCCATTGTGCGCTCTGAGAAGGTTAAAGATGAACTAGTGTTGGATGGAAATGATATTGAACTTGTTTCTCGGTCTGCTGCCTTGATAAACCAGAAATGTCACGTAAAGAACAAAGATATCCGGAAGTTCCTTGATGGTATCTATGTCAGTGAAAAGGGAACTATGGCAGAGGAAGAATAA

Network for GWHGAAZE003730

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00347.24	Ribosomal_L6	12	90	3.90E-11
PF00347.24	Ribosomal_L6	102	181	1.30E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02940	RP-L9e, RPL9	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome
GO:0019843	molecular_function	rRNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	406.973
	SRR3591706	second leaf	301.398
	SRR3591707	mature leaf	103.692
	SRR3591708	Shoot apex	647.032
	SRR3591709	Stem	191.001
	SRR3591710	White floral bud	252.641
	SRR3591711	White flower	312.232
	SRR3591712	Green floral bud	407.054
	SRR3591713	Yellow flower	224.301
SRP173429	SRR8316895	Juvenile bud stage	252.243
	SRR8316896	Juvenile bud stage	308.626
	SRR8316897	Juvenile bud stage	186.178
	SRR8316894	Third green stage	121.972
	SRR8316900	Third green stage	473.809
	SRR8316901	Third green stage	447.005
	SRR8316898	Complete white stage	135.680
	SRR8316899	Complete white stage	334.044
	SRR8316903	Complete white stage	176.715
	SRR8316902	Silver flowering stage	153.069
	SRR8316904	Silver flowering stage	128.800
	SRR8316905	Silver flowering stage	74.468
	SRR8316906	Gold flowering stage	246.885
	SRR8316907	Gold flowering stage	272.831
	SRR8316908	Gold flowering stage	327.074
SRP132670	SRR6706286	Control	419.714
	SRR6706287	Light intensity 50%	445.863
	SRR6706288	Light intensity 20%	487.222
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	449.243
	CNS0095593	Slightly white alabastrum(diploid) 2	486.247
	CNS0095594	Slightly white alabastrum(diploid) 3	423.698
	CNS0095595	Whole white alabastrum(diploid) 2	411.681
	CNS0095596	Whole white alabastrum(diploid) 3	496.580
	CNS0095597	Whole white alabastrum(diploid) 4	324.373
	CNS0095598	Silvery flower (diploied) 1	243.400
	CNS0095599	Silvery flower (diploied) 2	218.957
	CNS0095600	Silvery flower (diploied) 3	211.361
	CNS0095601	Golden flower (diploid) 1	176.604
	CNS0095602	Golden flower (diploid) 2	157.955
	CNS0095603	Golden flower (diploid) 3	158.697
	CNS0095604	Slightly white alabastrum(tetraploid) 1	450.132
	CNS0095605	Slightly white alabastrum(tetraploid) 2	465.751
	CNS0095606	Slightly white alabastrum(tetraploid) 3	514.750
	CNS0095607	Whole white alabastrum(tetraploid) 1	308.340
	CNS0095608	Whole white alabastrum(tetraploid) 2	254.021
	CNS0095609	Whole white alabastrum(tetraploid) 3	478.088
	CNS0095610	Silvery flower (tetraploid) 1	242.213
	CNS0095611	Silvery flower (tetraploid) 2	171.268
	CNS0095612	Silvery flower (tetraploid) 3	214.107
	CNS0095613	Golden flower (tetraploid) 1	157.428
	CNS0095614	Golden flower (tetraploid) 2	198.662
	CNS0095615	Golden flower (tetraploid) 3	113.230
CRA001975	CRR073297	Stem 1	404.909
	CRR073298	Stem 2	409.784
	CRR073299	Stem 3	394.711
	CRR073300	Leaf 1	376.642
	CRR073301	Leaf 2	414.615
	CRR073302	Leaf 3	494.921
	CRR073303	Juvenile bud 1	335.299
	CRR073304	Juvenile bud 2	346.125
	CRR073305	Juvenile bud 3	239.852
	CRR073306	Third green 1	166.191
	CRR073307	Third green 2	153.016
	CRR073308	Third green 3	166.315
	CRR073309	Second white 1	124.464
	CRR073310	Second white 2	121.184
	CRR073311	Second white 3	82.902
	CRR073312	Silver flowering 1	123.248
	CRR073313	Silver flowering 2	156.829
	CRR073314	Silver flowering 3	139.087
	CRR073315	Gold flowering 1	117.308
	CRR073316	Gold flowering 2	137.427
	CRR073317	Gold flowering 3	95.157
	CRR073318	Tawny withering 1	303.923
	CRR073319	Tawny withering 2	247.839
	CRR073320	Tawny withering 3	306.605