Gene detail

Detail information of GWHGAAZE003734

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002321344.1	3.5047E-95	hypothetical protein POPTR_0015s00340g [Populus trichocarpa]
Swissprot	tr\|Q6AWV1\|POP5_ARATH	7E-70	Probable ribonuclease P/MRP protein subunit POP5
trEMBL	tr\|B9IDE0\|B9IDE0_POPTR	1E-95	Uncharacterized protein {ECO:0000313\|EMBL:EEF05471.1}
TAIR10	AT1G04635.1	1E-55	ribonuclease P family protein / Rpp14 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	103092368	103093625	-
GWHAAZE00000001	mRNA	103092368	103093625	-
GWHAAZE00000001	exon	103092368	103092516	-
GWHAAZE00000001	exon	103093223	103093360	-
GWHAAZE00000001	exon	103093448	103093625	-
GWHAAZE00000001	CDS	103093448	103093625	-
GWHAAZE00000001	CDS	103093223	103093360	-
GWHAAZE00000001	CDS	103092368	103092516	-

Transcript Sequence
>GWHTAAZE003740 ATGGTGGGATTTAAAAACCGATACCTGGTGATGGAAGTTTTTTTGGATCCAAATCGAGAGCTTGCCGCAGAGGACCCCATTATAGTTACCCAATTTAATGTGTCAAAAGCAGTCAAAGAAAGCATTCTTTTGAACTTTGGTGAGTGTGGTCTTGCTTCATCAGTTGGGTCATTCCAAGTGAAGTACGTGAATCCCATTACAAAACTGTGCATTATCAGATCCTCAAGGGAGGAGTACCAAAAAGTTTGGTCAGCAATTACCATGGTCAGGAGCATCGGAAATTGCCCAGTGATGTTCAACTTACTGGACCTGAGTGGAAGTGTCAAGGCTTGTAGAAATGCAGCTTTAAAGTGTGATGAATTGAAATTCGAGCACTACAAGCTTGTCGATGGAACACGCCTCACAGCTGATGTTAACCAGCACATGCCGAACTGCCTTGAGAAGATCAAAATTTTAGAGCACTGA

Network for GWHGAAZE003734

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01900.20	RNase_P_Rpp14	7	115	5.70E-27

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03537	POP5	RNA transport	map03013
K03537	POP5	Ribosome biogenesis in eukaryotes	map03008

Gene Ontology

GO term	Ontology	Name
GO:0008033	biological_process	tRNA processing
GO:0004540	molecular_function	ribonuclease activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	15.506
	SRR3591706	second leaf	14.896
	SRR3591707	mature leaf	22.680
	SRR3591708	Shoot apex	19.119
	SRR3591709	Stem	29.313
	SRR3591710	White floral bud	23.306
	SRR3591711	White flower	24.496
	SRR3591712	Green floral bud	23.040
	SRR3591713	Yellow flower	25.070
SRP173429	SRR8316895	Juvenile bud stage	14.013
	SRR8316896	Juvenile bud stage	26.121
	SRR8316897	Juvenile bud stage	6.895
	SRR8316894	Third green stage	8.820
	SRR8316900	Third green stage	22.780
	SRR8316901	Third green stage	23.974
	SRR8316898	Complete white stage	7.877
	SRR8316899	Complete white stage	22.339
	SRR8316903	Complete white stage	11.318
	SRR8316902	Silver flowering stage	9.855
	SRR8316904	Silver flowering stage	12.514
	SRR8316905	Silver flowering stage	4.862
	SRR8316906	Gold flowering stage	18.771
	SRR8316907	Gold flowering stage	24.292
	SRR8316908	Gold flowering stage	13.806
SRP132670	SRR6706286	Control	19.608
	SRR6706287	Light intensity 50%	18.952
	SRR6706288	Light intensity 20%	20.114
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	23.159
	CNS0095593	Slightly white alabastrum(diploid) 2	23.662
	CNS0095594	Slightly white alabastrum(diploid) 3	21.689
	CNS0095595	Whole white alabastrum(diploid) 2	21.051
	CNS0095596	Whole white alabastrum(diploid) 3	22.892
	CNS0095597	Whole white alabastrum(diploid) 4	18.502
	CNS0095598	Silvery flower (diploied) 1	26.043
	CNS0095599	Silvery flower (diploied) 2	19.011
	CNS0095600	Silvery flower (diploied) 3	21.886
	CNS0095601	Golden flower (diploid) 1	24.621
	CNS0095602	Golden flower (diploid) 2	21.994
	CNS0095603	Golden flower (diploid) 3	24.084
	CNS0095604	Slightly white alabastrum(tetraploid) 1	16.835
	CNS0095605	Slightly white alabastrum(tetraploid) 2	16.299
	CNS0095606	Slightly white alabastrum(tetraploid) 3	16.074
	CNS0095607	Whole white alabastrum(tetraploid) 1	12.242
	CNS0095608	Whole white alabastrum(tetraploid) 2	11.242
	CNS0095609	Whole white alabastrum(tetraploid) 3	13.343
	CNS0095610	Silvery flower (tetraploid) 1	13.640
	CNS0095611	Silvery flower (tetraploid) 2	13.286
	CNS0095612	Silvery flower (tetraploid) 3	14.002
	CNS0095613	Golden flower (tetraploid) 1	14.752
	CNS0095614	Golden flower (tetraploid) 2	13.649
	CNS0095615	Golden flower (tetraploid) 3	10.148
CRA001975	CRR073297	Stem 1	23.490
	CRR073298	Stem 2	22.757
	CRR073299	Stem 3	13.266
	CRR073300	Leaf 1	19.636
	CRR073301	Leaf 2	19.621
	CRR073302	Leaf 3	8.293
	CRR073303	Juvenile bud 1	11.342
	CRR073304	Juvenile bud 2	10.136
	CRR073305	Juvenile bud 3	10.834
	CRR073306	Third green 1	6.100
	CRR073307	Third green 2	6.539
	CRR073308	Third green 3	8.749
	CRR073309	Second white 1	9.482
	CRR073310	Second white 2	14.832
	CRR073311	Second white 3	11.141
	CRR073312	Silver flowering 1	8.409
	CRR073313	Silver flowering 2	10.324
	CRR073314	Silver flowering 3	6.363
	CRR073315	Gold flowering 1	7.496
	CRR073316	Gold flowering 2	17.991
	CRR073317	Gold flowering 3	5.464
	CRR073318	Tawny withering 1	18.990
	CRR073319	Tawny withering 2	18.484
	CRR073320	Tawny withering 3	13.785