Gene detail

Detail information of GWHGAAZE003745

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP05829.1	5.43924E-74	unnamed protein product [Coffea canephora]
COG	YP_003226589.1	5E-33	thermoresistant glucokinase family carbohydrate kinase
trEMBL	tr\|A0A068UCB1\|A0A068UCB1_COFCA	2E-74	Coffea canephora DH200=94 genomic scaffold, scaffold_19 {ECO:0000313\|EMBL:CDP05829.1}
TAIR10	AT2G16790.1	3E-41	P-loop containing nucleoside triphosphate hydrolases superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	103253854	103254648	-
GWHAAZE00000001	mRNA	103253854	103254648	-
GWHAAZE00000001	exon	103254582	103254648	-
GWHAAZE00000001	exon	103253854	103254263	-
GWHAAZE00000001	CDS	103254582	103254648	-
GWHAAZE00000001	CDS	103253854	103254263	-

Transcript Sequence
>GWHTAAZE003751 ATGCTTGCAAAGTTTCTAAAGTGCAGGTTCCTCGACGCTGATGATTTCCACCCCGAATCAAACAAAGAAAAGATGAAGAGAGGGATCCCTTTATCAGATGAAGACCGCATTCCATGGCTTGAAATGCTAAGAGATACCCTAAATGCAAGTTTAGCCAGTGGTGAAAGTGTGATTCTTGGGTGCTCTGCTCTGCAAAAGCGTTACAGAGAAATTCTGAGGTCTGCCAACCCAAGTTACAAACCCTGTACTTATGCTACATCATCAAGCTTAGTGAAGTTTGTTTTGTTGGAGGTTGGGGTTGATGTGCTTGTTGCTCGGCTAGAGGAAAGAGCCGCAAAAGGGAAGCATTTCATGCCAGCCAAGCTGCTGCAGTCTCAGCTGGATTTGCTTCAGATTGACGAATCTGAAGGAATACTCAAGGTTGATGCTACACAAAGTCCCCAAGCCATTGTGAACACCATACAGCAAAAGCTCTGA

Network for GWHGAAZE003745

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01202.23	SKI	1	157	2.80E-08

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00851	E2.7.1.12, gntK, idnK	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Microbial metabolism in diverse environments	map01120
		Carbon metabolism	map01200
		Pentose phosphate pathway	map00030

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0016301	molecular_function	kinase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	8.763
	SRR3591706	second leaf	7.844
	SRR3591707	mature leaf	29.063
	SRR3591708	Shoot apex	11.865
	SRR3591709	Stem	34.657
	SRR3591710	White floral bud	28.886
	SRR3591711	White flower	32.384
	SRR3591712	Green floral bud	25.079
	SRR3591713	Yellow flower	51.295
SRP173429	SRR8316895	Juvenile bud stage	17.804
	SRR8316896	Juvenile bud stage	34.148
	SRR8316897	Juvenile bud stage	13.325
	SRR8316894	Third green stage	12.708
	SRR8316900	Third green stage	45.185
	SRR8316901	Third green stage	52.729
	SRR8316898	Complete white stage	28.561
	SRR8316899	Complete white stage	67.833
	SRR8316903	Complete white stage	35.869
	SRR8316902	Silver flowering stage	25.453
	SRR8316904	Silver flowering stage	34.226
	SRR8316905	Silver flowering stage	19.040
	SRR8316906	Gold flowering stage	65.654
	SRR8316907	Gold flowering stage	58.700
	SRR8316908	Gold flowering stage	74.921
SRP132670	SRR6706286	Control	49.730
	SRR6706287	Light intensity 50%	51.845
	SRR6706288	Light intensity 20%	53.995
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	40.820
	CNS0095593	Slightly white alabastrum(diploid) 2	36.202
	CNS0095594	Slightly white alabastrum(diploid) 3	31.140
	CNS0095595	Whole white alabastrum(diploid) 2	42.902
	CNS0095596	Whole white alabastrum(diploid) 3	51.373
	CNS0095597	Whole white alabastrum(diploid) 4	48.747
	CNS0095598	Silvery flower (diploied) 1	40.567
	CNS0095599	Silvery flower (diploied) 2	38.742
	CNS0095600	Silvery flower (diploied) 3	56.054
	CNS0095601	Golden flower (diploid) 1	46.476
	CNS0095602	Golden flower (diploid) 2	47.703
	CNS0095603	Golden flower (diploid) 3	46.863
	CNS0095604	Slightly white alabastrum(tetraploid) 1	34.454
	CNS0095605	Slightly white alabastrum(tetraploid) 2	27.155
	CNS0095606	Slightly white alabastrum(tetraploid) 3	32.244
	CNS0095607	Whole white alabastrum(tetraploid) 1	25.354
	CNS0095608	Whole white alabastrum(tetraploid) 2	25.177
	CNS0095609	Whole white alabastrum(tetraploid) 3	46.021
	CNS0095610	Silvery flower (tetraploid) 1	62.085
	CNS0095611	Silvery flower (tetraploid) 2	55.377
	CNS0095612	Silvery flower (tetraploid) 3	56.644
	CNS0095613	Golden flower (tetraploid) 1	49.561
	CNS0095614	Golden flower (tetraploid) 2	54.067
	CNS0095615	Golden flower (tetraploid) 3	62.590
CRA001975	CRR073297	Stem 1	42.155
	CRR073298	Stem 2	35.753
	CRR073299	Stem 3	33.322
	CRR073300	Leaf 1	62.345
	CRR073301	Leaf 2	62.733
	CRR073302	Leaf 3	52.575
	CRR073303	Juvenile bud 1	62.970
	CRR073304	Juvenile bud 2	60.092
	CRR073305	Juvenile bud 3	57.761
	CRR073306	Third green 1	42.625
	CRR073307	Third green 2	46.501
	CRR073308	Third green 3	40.319
	CRR073309	Second white 1	46.102
	CRR073310	Second white 2	59.680
	CRR073311	Second white 3	36.613
	CRR073312	Silver flowering 1	51.672
	CRR073313	Silver flowering 2	60.330
	CRR073314	Silver flowering 3	56.555
	CRR073315	Gold flowering 1	41.053
	CRR073316	Gold flowering 2	50.080
	CRR073317	Gold flowering 3	31.781
	CRR073318	Tawny withering 1	65.408
	CRR073319	Tawny withering 2	71.243
	CRR073320	Tawny withering 3	61.887