Gene detail

Detail information of GWHGAAZE003770

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008378356.1	6.75693E-84	PREDICTED: OTU domain-containing protein DDB_G0284757-like isoform X1 [Malus domestica]
trEMBL	tr\|A0A067FMD2\|A0A067FMD2_CITSI	4E-83	Uncharacterized protein {ECO:0000313\|EMBL:KDO64346.1}
TAIR10	AT3G22260.1	2E-61	Cysteine proteinases superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	103819230	103824557	+
GWHAAZE00000001	mRNA	103819230	103824557	+
GWHAAZE00000001	exon	103819230	103819328	+
GWHAAZE00000001	exon	103819506	103819580	+
GWHAAZE00000001	exon	103820711	103820784	+
GWHAAZE00000001	exon	103820903	103820951	+
GWHAAZE00000001	exon	103822893	103822977	+
GWHAAZE00000001	exon	103824310	103824366	+
GWHAAZE00000001	exon	103824451	103824557	+
GWHAAZE00000001	CDS	103819230	103819328	+
GWHAAZE00000001	CDS	103819506	103819580	+
GWHAAZE00000001	CDS	103820711	103820784	+
GWHAAZE00000001	CDS	103820903	103820951	+
GWHAAZE00000001	CDS	103822893	103822977	+
GWHAAZE00000001	CDS	103824310	103824366	+
GWHAAZE00000001	CDS	103824451	103824557	+

Transcript Sequence
>GWHTAAZE003776 TGTGCATTTGTTGTTTACGCCTGTTGGGTTTGTCTTTCATTCAGATTGGCAACTTATGGTTTAGCCGAACTGCAAATTGAGGGAGACGGCAATTGTCAGTTTCGAGCCCTTGCAGATCAGTTGTTTCGAAATCCCGATTACCACAAGCATGTCAGAAAGCAGATTGTAAAACAGCTAAAACACCACAAAAGGTTGTACGAAGGATATGTCCCAATGAATTATAAGAGCTATTTGAGGAAGATGAAAAGATCGGGGGAATGGGGAGATCATCTTACCTTACAAGCAGCTGCAGACCGTTTTGGAGCAAAAATTTGTTTAGTCACGTCTTTTCGAGATACCTACTATATTGAGATCTTTCCCAAGGACGGGAATCCTTCCAAAGAGCTATGGCTGAGCTTTTGGAGTGAAGTACATTACAATTCCTTGTATGGAAGCGGAGCTAACGTGCCGGTTATATTTTCTTTTTTGTTCGACAGAGGTTCCAACGAGAGTTCCAAGAAAGAAGCATTGGCTTTTCTAGAGCTTCAACCATCAATGTACTTGTAG

Network for GWHGAAZE003770

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02338.20	OTU	28	117	3.30E-12

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	OTU

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	13.575
	SRR3591706	second leaf	11.107
	SRR3591707	mature leaf	8.612
	SRR3591708	Shoot apex	8.768
	SRR3591709	Stem	30.805
	SRR3591710	White floral bud	17.820
	SRR3591711	White flower	33.650
	SRR3591712	Green floral bud	13.771
	SRR3591713	Yellow flower	57.508
SRP173429	SRR8316895	Juvenile bud stage	9.793
	SRR8316896	Juvenile bud stage	15.081
	SRR8316897	Juvenile bud stage	6.227
	SRR8316894	Third green stage	6.294
	SRR8316900	Third green stage	16.517
	SRR8316901	Third green stage	20.551
	SRR8316898	Complete white stage	14.155
	SRR8316899	Complete white stage	28.981
	SRR8316903	Complete white stage	16.934
	SRR8316902	Silver flowering stage	21.136
	SRR8316904	Silver flowering stage	19.737
	SRR8316905	Silver flowering stage	13.403
	SRR8316906	Gold flowering stage	58.235
	SRR8316907	Gold flowering stage	43.252
	SRR8316908	Gold flowering stage	54.730
SRP132670	SRR6706286	Control	12.343
	SRR6706287	Light intensity 50%	11.532
	SRR6706288	Light intensity 20%	8.921
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	21.357
	CNS0095593	Slightly white alabastrum(diploid) 2	14.509
	CNS0095594	Slightly white alabastrum(diploid) 3	20.083
	CNS0095595	Whole white alabastrum(diploid) 2	8.455
	CNS0095596	Whole white alabastrum(diploid) 3	10.194
	CNS0095597	Whole white alabastrum(diploid) 4	13.308
	CNS0095598	Silvery flower (diploied) 1	23.936
	CNS0095599	Silvery flower (diploied) 2	18.867
	CNS0095600	Silvery flower (diploied) 3	23.461
	CNS0095601	Golden flower (diploid) 1	16.061
	CNS0095602	Golden flower (diploid) 2	39.930
	CNS0095603	Golden flower (diploid) 3	32.622
	CNS0095604	Slightly white alabastrum(tetraploid) 1	11.561
	CNS0095605	Slightly white alabastrum(tetraploid) 2	9.549
	CNS0095606	Slightly white alabastrum(tetraploid) 3	10.753
	CNS0095607	Whole white alabastrum(tetraploid) 1	6.337
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.608
	CNS0095609	Whole white alabastrum(tetraploid) 3	9.074
	CNS0095610	Silvery flower (tetraploid) 1	13.605
	CNS0095611	Silvery flower (tetraploid) 2	16.492
	CNS0095612	Silvery flower (tetraploid) 3	16.241
	CNS0095613	Golden flower (tetraploid) 1	20.159
	CNS0095614	Golden flower (tetraploid) 2	15.109
	CNS0095615	Golden flower (tetraploid) 3	25.238
CRA001975	CRR073297	Stem 1	10.407
	CRR073298	Stem 2	10.410
	CRR073299	Stem 3	8.017
	CRR073300	Leaf 1	9.042
	CRR073301	Leaf 2	8.606
	CRR073302	Leaf 3	6.630
	CRR073303	Juvenile bud 1	5.055
	CRR073304	Juvenile bud 2	8.088
	CRR073305	Juvenile bud 3	6.361
	CRR073306	Third green 1	9.593
	CRR073307	Third green 2	14.606
	CRR073308	Third green 3	9.957
	CRR073309	Second white 1	11.562
	CRR073310	Second white 2	14.706
	CRR073311	Second white 3	11.380
	CRR073312	Silver flowering 1	12.210
	CRR073313	Silver flowering 2	14.073
	CRR073314	Silver flowering 3	13.031
	CRR073315	Gold flowering 1	4.436
	CRR073316	Gold flowering 2	8.189
	CRR073317	Gold flowering 3	5.640
	CRR073318	Tawny withering 1	6.615
	CRR073319	Tawny withering 2	6.462
	CRR073320	Tawny withering 3	12.372