Gene detail

Detail information of GWHGAAZE003790

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011001038.1	1.7377E-116	PREDICTED: choline-phosphate cytidylyltransferase 1 [Populus euphratica]
COG	YP_004672440.1	1E-19	hypothetical protein SNE_A20720
Swissprot	tr\|F4JJE0\|CCT2_ARATH	1E-111	Choline-phosphate cytidylyltransferase 2
trEMBL	tr\|I1JJV2\|I1JJV2_SOYBN	2E-115	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GLYMA02G48000.1}
TAIR10	AT4G15130.1	1E-89	phosphorylcholine cytidylyltransferase2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	104345044	104347192	-
GWHAAZE00000001	mRNA	104345044	104347192	-
GWHAAZE00000001	exon	104345044	104345205	-
GWHAAZE00000001	exon	104345340	104345382	-
GWHAAZE00000001	exon	104345522	104345617	-
GWHAAZE00000001	exon	104345896	104346009	-
GWHAAZE00000001	exon	104347017	104347192	-
GWHAAZE00000001	CDS	104347017	104347192	-
GWHAAZE00000001	CDS	104345896	104346009	-
GWHAAZE00000001	CDS	104345522	104345617	-
GWHAAZE00000001	CDS	104345340	104345382	-
GWHAAZE00000001	CDS	104345044	104345205	-

Transcript Sequence
>GWHTAAZE003796 ATGATAGAGGAAGTTCCAACGGAGGAGAATGAGCATATGAATATGAAGAAGCAGAAGGGTAATAATTGGAAGACGAATCCTCCACCGTCGGATCGCCCAGTCCGTGTCTACGCTGATGGCATCTACGATCTCTTCCACTTCGGTCACGCTCGCTCCCTCGAGCAAGCCAAAAAATCGTTTCCCAACACCTATTTGCTGGTTGGATGCTGCAATGATGAAATTACACACAAGTTTAAGGGTAAAACTGTAATGACTGAATCGGAGCGATATGAATCCCTTCGCCATTGCAAGTGGGTTGATGAAGTTATTCCTGACGCTCCATGGGTGCTCAGTCAGGAATTTATTGACAAGCATAACATTGACTATGTGGCCCATGATTCTCTTCCTTATGCTGATGCTAGCGGAGCTGCAAATGATGTTTATGAATTTGTCAAATCCATTGGAAAGTTCAAGGAAACAAAACGCACAGATGGAATTTCAACATCAGACATTATAATGAGAATTGTTAAAGATTATAACCAGTATGTGTTGCGTAACTTGGATCGTGGATATTCTAGAAAAGAACTTGGTGTTAGCTACGTCAAGGCATGA

Network for GWHGAAZE003790

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01467.27	CTP_transf_like	37	166	4.70E-33

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00968	PCYT1	Metabolic pathways	map01100
		Glycerophospholipid metabolism	map00564
		Phosphonate and phosphinate metabolism	map00440

Gene Ontology

GO term	Ontology	Name
GO:0009058	biological_process	biosynthetic process
GO:0003824	molecular_function	catalytic activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.177
	SRR3591706	second leaf	0.527
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	1.180
	SRR3591709	Stem	0.929
	SRR3591710	White floral bud	16.226
	SRR3591711	White flower	2.266
	SRR3591712	Green floral bud	12.781
	SRR3591713	Yellow flower	4.665
SRP173429	SRR8316895	Juvenile bud stage	2.150
	SRR8316896	Juvenile bud stage	10.839
	SRR8316897	Juvenile bud stage	1.574
	SRR8316894	Third green stage	5.990
	SRR8316900	Third green stage	19.196
	SRR8316901	Third green stage	17.630
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	1.525
	SRR8316903	Complete white stage	1.011
	SRR8316902	Silver flowering stage	0.129
	SRR8316904	Silver flowering stage	0.679
	SRR8316905	Silver flowering stage	0.193
	SRR8316906	Gold flowering stage	1.307
	SRR8316907	Gold flowering stage	1.925
	SRR8316908	Gold flowering stage	2.328
SRP132670	SRR6706286	Control	7.550
	SRR6706287	Light intensity 50%	8.853
	SRR6706288	Light intensity 20%	7.963
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	8.496
	CNS0095593	Slightly white alabastrum(diploid) 2	6.416
	CNS0095594	Slightly white alabastrum(diploid) 3	10.611
	CNS0095595	Whole white alabastrum(diploid) 2	12.190
	CNS0095596	Whole white alabastrum(diploid) 3	11.558
	CNS0095597	Whole white alabastrum(diploid) 4	11.434
	CNS0095598	Silvery flower (diploied) 1	3.514
	CNS0095599	Silvery flower (diploied) 2	5.235
	CNS0095600	Silvery flower (diploied) 3	3.451
	CNS0095601	Golden flower (diploid) 1	4.750
	CNS0095602	Golden flower (diploid) 2	4.646
	CNS0095603	Golden flower (diploid) 3	4.486
	CNS0095604	Slightly white alabastrum(tetraploid) 1	13.544
	CNS0095605	Slightly white alabastrum(tetraploid) 2	13.268
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.713
	CNS0095607	Whole white alabastrum(tetraploid) 1	16.745
	CNS0095608	Whole white alabastrum(tetraploid) 2	23.663
	CNS0095609	Whole white alabastrum(tetraploid) 3	17.257
	CNS0095610	Silvery flower (tetraploid) 1	3.298
	CNS0095611	Silvery flower (tetraploid) 2	7.262
	CNS0095612	Silvery flower (tetraploid) 3	9.330
	CNS0095613	Golden flower (tetraploid) 1	2.422
	CNS0095614	Golden flower (tetraploid) 2	5.140
	CNS0095615	Golden flower (tetraploid) 3	6.484
CRA001975	CRR073297	Stem 1	4.674
	CRR073298	Stem 2	6.667
	CRR073299	Stem 3	4.114
	CRR073300	Leaf 1	9.287
	CRR073301	Leaf 2	9.101
	CRR073302	Leaf 3	5.796
	CRR073303	Juvenile bud 1	10.181
	CRR073304	Juvenile bud 2	9.886
	CRR073305	Juvenile bud 3	1.879
	CRR073306	Third green 1	5.857
	CRR073307	Third green 2	10.069
	CRR073308	Third green 3	8.125
	CRR073309	Second white 1	0.577
	CRR073310	Second white 2	3.689
	CRR073311	Second white 3	4.634
	CRR073312	Silver flowering 1	7.457
	CRR073313	Silver flowering 2	9.242
	CRR073314	Silver flowering 3	3.488
	CRR073315	Gold flowering 1	6.780
	CRR073316	Gold flowering 2	4.652
	CRR073317	Gold flowering 3	2.776
	CRR073318	Tawny withering 1	9.832
	CRR073319	Tawny withering 2	9.734
	CRR073320	Tawny withering 3	10.729