Gene detail

Detail information of GWHGAAZE003852

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009348829.1	2.93576E-83	PREDICTED: RING-H2 finger protein ATL70-like [Pyrus x bretschneideri]
Swissprot	tr\|Q8RX29\|ATL70_ARATH	7E-55	RING-H2 finger protein ATL70
trEMBL	tr\|A0A068UPW0\|A0A068UPW0_COFCA	6E-82	Coffea canephora DH200=94 genomic scaffold, scaffold_45 {ECO:0000313\|EMBL:CDP10580.1}
TAIR10	AT2G35910.1	7E-28	RING/U-box superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	105761021	105761521	+
GWHAAZE00000001	mRNA	105761021	105761521	+
GWHAAZE00000001	exon	105761021	105761521	+
GWHAAZE00000001	CDS	105761021	105761521	+

Transcript Sequence
>GWHTAAZE003858 ATGAACACAACCACCAGCTCAGGCGGCTTCTTGGGCTCTCAACACATCGGTGGATTTGGCTACGGAATTGGCGTATCCGTCGGAATCCTCCTCCTCATCACAACCATAACCTTAGCCTCATACTTTTGCACAAGGGTCCAATCCCCGCCAAACCAACGCCACCGGCCACCACCACCGCAACTGCAAGACCACCACCACGTGGTGGTGGACGTGGGGCTTGACGAGGCCACCCTCTTGACCTACCCGAAACTACTCTACTCCGAGGCGAAGGTCAACAAAAACGACTCGACCTCGACTTGTTGCTCGGTATGCTTGGCGGATTATAAGGGTAGTGATATGCTAAGGCTATTGCCGGATTGTGGGCATCTCTTTCATCTCAAGTGTGTCGATCCATGGCTGAGATTGCACCCCACTTGTCCGGTCTGCCGGACTTCGCCCCTGCCTACGCCATTGTCTACTCCGTTGGCCGAGGTGGTTCCACTGGCTAGTAGAAGGGATTGA

Network for GWHGAAZE003852

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13639.7	zf-RING_2	101	143	5.80E-12

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	RING
Ubiquitin Family	U-box

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.510
	SRR3591706	second leaf	0.167
	SRR3591707	mature leaf	0.320
	SRR3591708	Shoot apex	2.211
	SRR3591709	Stem	0.366
	SRR3591710	White floral bud	0.157
	SRR3591711	White flower	0.229
	SRR3591712	Green floral bud	0.354
	SRR3591713	Yellow flower	1.908
SRP173429	SRR8316895	Juvenile bud stage	0.506
	SRR8316896	Juvenile bud stage	0.683
	SRR8316897	Juvenile bud stage	0.428
	SRR8316894	Third green stage	0.266
	SRR8316900	Third green stage	0.185
	SRR8316901	Third green stage	0.446
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.104
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.240
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.186
	SRR8316906	Gold flowering stage	0.530
	SRR8316907	Gold flowering stage	0.552
	SRR8316908	Gold flowering stage	0.640
SRP132670	SRR6706286	Control	0.657
	SRR6706287	Light intensity 50%	0.438
	SRR6706288	Light intensity 20%	0.345
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.574
	CNS0095593	Slightly white alabastrum(diploid) 2	0.354
	CNS0095594	Slightly white alabastrum(diploid) 3	0.602
	CNS0095595	Whole white alabastrum(diploid) 2	0.389
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.349
	CNS0095599	Silvery flower (diploied) 2	0.146
	CNS0095600	Silvery flower (diploied) 3	0.410
	CNS0095601	Golden flower (diploid) 1	0.151
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.722
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.214
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.351
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.719
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.070
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.084
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	1.004
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.507
	CNS0095613	Golden flower (tetraploid) 1	0.091
	CNS0095614	Golden flower (tetraploid) 2	0.192
	CNS0095615	Golden flower (tetraploid) 3	1.827
CRA001975	CRR073297	Stem 1	1.282
	CRR073298	Stem 2	0.738
	CRR073299	Stem 3	0.743
	CRR073300	Leaf 1	0.374
	CRR073301	Leaf 2	1.186
	CRR073302	Leaf 3	0.122
	CRR073303	Juvenile bud 1	0.328
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.079
	CRR073306	Third green 1	2.958
	CRR073307	Third green 2	0.453
	CRR073308	Third green 3	2.412
	CRR073309	Second white 1	1.074
	CRR073310	Second white 2	0.101
	CRR073311	Second white 3	1.232
	CRR073312	Silver flowering 1	0.696
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.336
	CRR073315	Gold flowering 1	0.779
	CRR073316	Gold flowering 2	1.062
	CRR073317	Gold flowering 3	1.365
	CRR073318	Tawny withering 1	1.200
	CRR073319	Tawny withering 2	0.383
	CRR073320	Tawny withering 3	0.432