Gene detail

Detail information of GWHGAAZE003901

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CBI19586.3	1.20043E-73	unnamed protein product [Vitis vinifera]
COG	YP_007160577.1	2E-39	signal peptidase I
Swissprot	tr\|O04348\|TPP1_ARATH	9E-63	Thylakoidal processing peptidase 1, chloroplastic (Precursor)
trEMBL	tr\|E0CPC9\|E0CPC9_VITVI	4E-74	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI19586.3}
TAIR10	AT2G30440.1	7E-52	thylakoid processing peptide

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	106747033	106747461	+
GWHAAZE00000001	mRNA	106747033	106747461	+
GWHAAZE00000001	exon	106747033	106747461	+
GWHAAZE00000001	CDS	106747033	106747461	+

Transcript Sequence
>GWHTAAZE003907 ATGGTAGCAGAGAAGGTTTCATATATTTTCAGGCAGCCTGAAGTTTCGGACATAGTTATATTCAAGGTGCCTTCCTTTCTTCAGGCATATGGTTGTAGGCTGGGTGAAGTCTTTATAAAAAGAGTTGTAGCCAAGGCCGGAGACTACGTCGAAGTTCGTGATGGTAAATTAATAGTGAACAATAATGTTCAAGACGAAGAATACATTTTGGAGCCACTTGCTTATGAAATGGATCCGCAGGTTGTGCCTGAAGGATGTGTATTTGTGTTGGGGGACAACCGTAATAACAGTTTTGATTCACATAACTGGGGTCCGCTTCCTATCGAAAATATTTTGGGGAGATCGGTGCTCCGGTATTGGCCCCCATCCAAAGTATCCGACACTATATACGAACCACATTCAAGAAAAAAAGATGTTGCAGTGTCTTGA

Network for GWHGAAZE003901

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF10502.10	Peptidase_S26	2	120	7.10E-29

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03100	lepB	Protein export	map03060

Gene Ontology

GO term	Ontology	Name
GO:0006508	biological_process	proteolysis
GO:0016021	cellular_component	integral component of membrane
GO:0016020	cellular_component	membrane
GO:0008236	molecular_function	serine-type peptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	34.636
	SRR3591706	second leaf	17.262
	SRR3591707	mature leaf	18.419
	SRR3591708	Shoot apex	26.483
	SRR3591709	Stem	45.866
	SRR3591710	White floral bud	41.260
	SRR3591711	White flower	59.434
	SRR3591712	Green floral bud	45.775
	SRR3591713	Yellow flower	71.677
SRP173429	SRR8316895	Juvenile bud stage	11.179
	SRR8316896	Juvenile bud stage	12.254
	SRR8316897	Juvenile bud stage	7.964
	SRR8316894	Third green stage	7.402
	SRR8316900	Third green stage	25.802
	SRR8316901	Third green stage	27.847
	SRR8316898	Complete white stage	12.852
	SRR8316899	Complete white stage	39.578
	SRR8316903	Complete white stage	15.678
	SRR8316902	Silver flowering stage	15.588
	SRR8316904	Silver flowering stage	17.700
	SRR8316905	Silver flowering stage	9.694
	SRR8316906	Gold flowering stage	52.250
	SRR8316907	Gold flowering stage	50.887
	SRR8316908	Gold flowering stage	56.510
SRP132670	SRR6706286	Control	15.613
	SRR6706287	Light intensity 50%	16.697
	SRR6706288	Light intensity 20%	19.334
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	31.199
	CNS0095593	Slightly white alabastrum(diploid) 2	29.566
	CNS0095594	Slightly white alabastrum(diploid) 3	24.632
	CNS0095595	Whole white alabastrum(diploid) 2	30.319
	CNS0095596	Whole white alabastrum(diploid) 3	32.871
	CNS0095597	Whole white alabastrum(diploid) 4	25.446
	CNS0095598	Silvery flower (diploied) 1	35.657
	CNS0095599	Silvery flower (diploied) 2	42.102
	CNS0095600	Silvery flower (diploied) 3	57.812
	CNS0095601	Golden flower (diploid) 1	58.747
	CNS0095602	Golden flower (diploid) 2	65.423
	CNS0095603	Golden flower (diploid) 3	65.476
	CNS0095604	Slightly white alabastrum(tetraploid) 1	22.671
	CNS0095605	Slightly white alabastrum(tetraploid) 2	19.032
	CNS0095606	Slightly white alabastrum(tetraploid) 3	30.727
	CNS0095607	Whole white alabastrum(tetraploid) 1	19.935
	CNS0095608	Whole white alabastrum(tetraploid) 2	18.718
	CNS0095609	Whole white alabastrum(tetraploid) 3	27.709
	CNS0095610	Silvery flower (tetraploid) 1	46.607
	CNS0095611	Silvery flower (tetraploid) 2	46.194
	CNS0095612	Silvery flower (tetraploid) 3	43.410
	CNS0095613	Golden flower (tetraploid) 1	61.407
	CNS0095614	Golden flower (tetraploid) 2	68.866
	CNS0095615	Golden flower (tetraploid) 3	62.508
CRA001975	CRR073297	Stem 1	17.306
	CRR073298	Stem 2	17.016
	CRR073299	Stem 3	16.167
	CRR073300	Leaf 1	27.881
	CRR073301	Leaf 2	24.230
	CRR073302	Leaf 3	26.608
	CRR073303	Juvenile bud 1	48.960
	CRR073304	Juvenile bud 2	41.922
	CRR073305	Juvenile bud 3	41.351
	CRR073306	Third green 1	22.096
	CRR073307	Third green 2	21.676
	CRR073308	Third green 3	19.613
	CRR073309	Second white 1	31.625
	CRR073310	Second white 2	26.068
	CRR073311	Second white 3	15.397
	CRR073312	Silver flowering 1	18.413
	CRR073313	Silver flowering 2	16.832
	CRR073314	Silver flowering 3	19.916
	CRR073315	Gold flowering 1	12.195
	CRR073316	Gold flowering 2	14.864
	CRR073317	Gold flowering 3	10.393
	CRR073318	Tawny withering 1	20.217
	CRR073319	Tawny withering 2	31.858
	CRR073320	Tawny withering 3	19.928